Anchusa crispa

Viv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Anchusa

At a glance

Occurrence records355

Data sources5

Biological traits4

DNA specimens11

eDNA detections19

Sources5 archives

Databases and archives Anchusa crispa's data was compiled from.

GBIFGlobal Biodiversity Information Facility355 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources4 traits

Occurrence & distributionGBIF355 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD · NCBI11 specimens

02Traits & measurements

SourcesLEDAGIFTWCVPTRY

Size & morphology1

Seed mass2.78 mg

Life cycle & reproduction2

Dispersal typeanimal

Life formannual or biennial

Habitat & environment1

Climatesubtropical

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchusa crispa has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes3

GenBank sequences10

eDNA detections19

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLEU599904.1 ↗1 196 bpItaly

ACGT

GCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCTCCTGAAGAAGCAGGGGCCGCAGTAGCCGCTGAATCTTCTACTGGTACATGGACA …

Anchusa crispa isolate B148 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type355 records

Wild obs. + sensor268

Museum / vouchered82

Other5

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 87≤1 km 16≤10 km 74>10 km 15

192 georeferenced · 76 without coordinates

Open the mapobservation + sensor268

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 6≤10 km 29

35 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	38
CJBGlocation not on record	3
Loja, EC	2
JBSlocation not on record	2
ESP003location not on record	1
BRNUlocation not on record	1

6 institutions · 47 of 82 vouchered records shown · 29 without an institution code

09Environmental DNA19 detections

Where the DNA of Anchusa crispa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 13.5–14.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 17.7–18.9

Min temp (night)9.30 °C 8.70–9.30

Precipitation72.2 mm/mo 72.2–73.5

Air humidity58.3 % 58.3–59.5

Moisture balance-20.6 mm/mo -20.6–-16.8

Vapour deficit782 Pa 713–782

Wind speed2.60 m/s 2.60–3.20

Cloud cover40.9 % 40.9–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)