Anchusa azurea
Mill. · speciesAt a glance
Occurrence records9 022
Data sources12
Biological traits51
DNA specimens11
eDNA detections4
Sources12 archives
Databases and archives Anchusa azurea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 022 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources51 traits
Chemical compositionLOTUS · NPASS68 compounds
Occurrence & distributionGBIF9 022 records
Environmental DNA1 datasets · 2 countries4 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB2n = 32
01Narrative
La Buglosse d'Italie ou Buglosse azurée est une espèce de plantes herbacées de la famille des Boraginaceae. Synonyme : - Anchusa italica Retz. Certains auteurs, qui admettent la synonymie entre les deux noms, acceptent le nom de Anchusa italica Retz. et rejettent Anchusa azurea Mill. Pourtant la description de Miller est antérieure (1768) à celle de Retzius (1779). Il semble donc logique que le nom donné par Miller soit préféré, selon le code de nomenclature. Elle pousse dans les prairies tempérées d'Asie et d'Europe. Ses feuilles sont à pilosité rude et ses fleurs, d'un bleu très vif, mesurent de 15 à 25 mm de large.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAWCVP
Size & morphology18
Fruit length6 mm
Fruit length max7 mm
Fruit length min6 mm
Fruit width max3 mm
Leaf length200 mm
Leaf length max400 mm
Leaf length min100 mm
Leaf mass190 mg
Leaf size3 612 mm²
Leaf width55 mm
Leaf width max60 mm
Leaf width min30 mm
Plant height0.89 m
Plant height max1.5 m
Plant height min0.2 m
Seed mass17.41 mg
Seed mass max28.46 mg
Seed mass min2.2 mg
Life cycle & reproduction16
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourblue
Flower length max8 mm
Flower length min6.5 mm
Flower width max16 mm
Flower width min10 mm
Flowering endAug
Flowering startApr
Life formperennial
Life spanstrict monocarpic bi-annuals and poly-annuals
⚠ sources differ — LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: perennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Seed number324
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 400 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourbrown
Fruit typeachene
Growth formherb
Habitat GIFTgarden
Leaf formelliptic
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)123 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)19.04 mm²/mg
Other traits1
Shoot orientationerect
03Chemical composition68 compounds
Compounds documented for Anchusa azurea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Anthraquinones and anthrones14
Flavonols5
Simple phenolic acids4
Ursane and Taraxastane triterpenoids3
Monomeric stilbenes3
Documented compounds68 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (10S)-10-[(9R)-4,5-dihydroxy-2-methyl-10-oxo-9H-anthracen-9-yl]-1,3,8-trihydroxy-6-methyl-10H-anthracen-9-one | present | NPASS | |
| (3S,4aR,6aR,6aS,6bR,8aR,10R,11R,12aR,14bS)-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-10,11-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (3S,4aR,6aR,6aS,6bR,8aR,9R,10R,11R,12aR,14bS)-11-hydroxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-3,10-bis[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (S)-Rosmarinic acid | present | LOTUS | |
| 1,2,6-Tri-O-Galloyl-Beta-D-Glucose | present | NPASS | |
| 1,6-di-O-Galloylglucose | present | NPASS | |
| 1-[1-hydroxy-3-methyl-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxynaphthalen-2-yl]ethanone | present | NPASS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 3,4-dihydroxy-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[(3,4,5-trihydroxybenzoyl)oxymethyl]oxan-2-yl]oxybenzoic acid | present | NPASS | |
| 5,7-dihydroxy-2-(4-hydroxyphenyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one | present | LOTUS |
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchusa azurea has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes5
GenBank sequences10
eDNA detections4
Countries4
The DNA barcodea real sequence read deposited for this species
GAATCCTGCATAGCCGAACCACTCGTGAATAAGTTAGTAACAAATATGGCATGATGGTATGTGGGTATACCTCACATTCTAGTGTGCCTC …
Anchusa azurea internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Anchusa azurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records32–322n range32median32mode32records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3232×CCDB · ita-fl · CCDB · slov-fl · CCDB · iber-fl +10
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — VALSECCHI F. - 1976. Il genere "Anchusa" in Sardegna.. Webbia , 30(1): 43-68.
CCDB · ita-fl — D'AMATO G., TROJANI ZH. - 1985. Giemsa banding and karyotype in three species of Anchusa (Boraginaceae).. Caryologia , 38(1): 13-21.
CCDB · slov-fl — Murín A. & Májovský J., 1983: Karyological study of Slovakian flora IV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 30: 1-16.
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 246: 389-404(1972).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Estudios cariolgicos de Boraginceas espaolas. I. Anchusa. Luque, T.Lagascalia12(1): 81-97(1983).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3428
CCDB · mediterranean
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — VALSECCHI, F. 1976. Il genere Anchusa in Sardegna. Webbia 30: 43–68.
CCDB · ipcn-api-dl — D'Amato, G. & Z. Trojani. 1985. Giemsa banding and karyotype in three species of Anchusa (Boraginaceae). Caryologia 38: 13–21.
CCDB · ipcn-api-dl — Markova, M. & V. Goranova. 1995. Mediterranean chromosome number reports 5 (435--473). Fl. Medit. 5: 289–317.
CCDB · book-ipcn72 — FERNANDES, A., & M.T. LEITAO. 1972. Contribution a la connansance cytotaxonomique des Spermatophyta du Portugal v. Boraginaceae Bol. soc. Brat. 46(Ser. 2): 389 405.
CCDB · book-ipcn67-71 — MARKOWA, M., & P. IVANOVA. 1971. Karyologische Untersuchungen der Vertreter der Fam. Boraginaceae, Labiatae und Scrophulariaceae in Bulgarian. II. Mitt. Bot. Inst. Bulg. Akad. Wiss. 21: 123-131.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-indian_vol1 — Smith, S.G. 1931, 1932; Strey, M. 1931; Sugiura, T. 1931, 1936b, 1940b; Lewits- ky, G.A. 1940; Markova, M. & Ivanova, P. 1971
CCDB · book-fedorov — Smith S. G. 1931, 1932 sem
CCDB · book-fedorov — Strey 1931
CCDB · book-fedorov — Sugiura 1931, 1936b, 1940b Ce
CCDB · book-fedorov — JleBHTCKBi 1940
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1972). Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. V. Boraginaceae. Bol. Soc. Brot. 46: 389-405.
CCDB · CromoCat 2015 — Loon van, J. C. & de Jong, H. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIX]. Taxon 27(1): 56-61.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.
CCDB · CromoCat 2015 — Luque, T. (1983a). Estudios cariológicos de Boragináceas españolas. I. Anchusa. Lagascalia 12(1): 81-97.
CCDB · CromoCat 2015 — Valsecchi, F. (1976). Il genere Anchusa in Sardegna. Webbia 30: 43-68.
n 166×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 1-14. Valds, B., J. Pastor & J. Ubera.Lagascalia7(2): 192-197(1977).
CCDB · ipcn-api-dl — Valdes, B., J. Pastor & J. Ubera. 1978. In Numeros cromosomicos para la flora Espariola. 1-44. Lagascalia 7: 191–216.
CCDB · ipcn-api-dl — Ghaffari, S. M. 1996. Chromosome studies in some species of Boraginaceae from Iran. Iran. J. Bot. 7(1): 81–93.
CCDB · CromoCat 2015 — Britton, D. M. (1951). Cytogenetic studies on the Boraginaceae. Brittonia 7: 233-266.
CCDB · CromoCat 2015 — Valdés, B., J. Pastor & J. Ubera. (1977). Números cromosómicos para la flora española, 1-14. Lagascalia 7(2): 192-197.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type9 022 records
Wild obs. + sensor7 392
Museum / vouchered1 596
Cultivated / captive22
Other12
Origin
Native399
Introduced109
Range
Area of Occupancy AOO23 848 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy70% within 1 km
≤100 m 2 446≤1 km 1 399≤10 km 1 573>10 km 100
5 518 georeferenced · 1 874 without coordinates
Open the mapobservation + sensor7 392
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy69% within 1 km
≤100 m 41≤1 km 385≤10 km 183>10 km 8
617 georeferenced · 979 without coordinates
Open the institutions mapphysical evidence1 596
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 21
21 georeferenced · 1 without coordinates
Open the mapnot free-living22
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions63 of 114 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 266 |
| Berlin, DE | 165 |
| MAlocation not on record | 94 |
| Jaén, ES | 84 |
| College of the Atlantic, Museumlocation not on record | 79 |
| Moscow State Universitylocation not on record | 62 |
| CICYTEXlocation not on record | 51 |
| Wlocation not on record | 47 |
| València, ES | 41 |
| Barcelona, ES | 38 |
| BClocation not on record | 35 |
| MeiseBGlocation not on record | 31 |
| Badajoz, ES | 30 |
| Granada, ES | 26 |
| Córdoba, ES | 25 |
| Sevilla, ES | 25 |
| Madrid, ES | 24 |
| Entomological Society of Latvialocation not on record | 24 |
| LDlocation not on record | 22 |
| Salamanca, ES | 21 |
| UIBlocation not on record | 16 |
| Pullman, US | 15 |
| Phyletisches Museum Jenalocation not on record | 15 |
| BRNUlocation not on record | 13 |
| San Sebastián, ES | 13 |
| BFLlocation not on record | 13 |
| Turku, FI | 11 |
| Corvallis, US | 10 |
| Portland, US | 10 |
| Oskarshamn, SE | 9 |
| Zürich, CH | 8 |
| Pamplona, ES | 8 |
| Alicante, ES | 7 |
| Denver, US | 7 |
| Pretoria, ZA | 7 |
| Mlocation not on record | 7 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 7 |
| Zürich, CH | 6 |
| Porrentruy, CH | 6 |
| Olocation not on record | 6 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 6 |
| WTUlocation not on record | 6 |
| EEZA-CSIClocation not on record | 6 |
| Rishon Le Zion, IL | 6 |
| Dresden, DE | 5 |
| Provincia di Livornolocation not on record | 5 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 5 |
| Görlitz, DE | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Saint Louis, US | 4 |
| SLU Artdatabankenlocation not on record | 4 |
| Bronx, US | 4 |
| Baroda, IN | 3 |
| South Kensington, GB | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Brussel, BE | 3 |
| Frankfurt am Main | 3 |
| PRClocation not on record | 3 |
| GZUlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Pamplona, ES | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Cape Town, ZA | 3 |
| GJOlocation not on record | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 3 |
| Universität Göttingenlocation not on record | 3 |
| Claremont, US | 2 |
| Santa Barbara, US | 2 |
| Kew, GB | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Moscow, US | 2 |
| Göteborg, SE | 2 |
| BSBIlocation not on record | 2 |
| Oulu, FI | 2 |
| Museo Achille Folettolocation not on record | 2 |
| New Haven, US | 2 |
| Austin, US | 2 |
| Gijón, ES | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Logan, US | 1 |
| Ann Arbor, US | 1 |
| Spearfish, US | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| nlocation not on record | 1 |
| Davenport, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Auckland, NZ | 1 |
| Wuzhou, CN | 1 |
| DBF-NHMDlocation not on record | 1 |
| Tampa, US | 1 |
| Angwin, US | 1 |
| Christchurch, NZ | 1 |
| NMWlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Mississippi State, US | 1 |
| Salzburg, AT | 1 |
| TUR-Alocation not on record | 1 |
| Odawara, JP | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| Vancouver, CA | 1 |
| Tacoma, US | 1 |
| JBSlocation not on record | 1 |
| Boise, US | 1 |
| Missoula, US | 1 |
| Agriculture and Agri-Food Canadalocation not on record | 1 |
| Victoria, CA | 1 |
| Fort Worth, US | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| University of New Hampshirelocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Nanjing, CN | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Helsinki, FI | 1 |
| Chongqing Museumlocation not on record | 1 |
114 institutions · 1 544 of 1 596 vouchered records shown · 50 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Anchusa azurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.4 °C 10.4–24.0
Seasonal swing summer↔winter24.2 °C
Max temp (day)15.7 °C 15.7–29.1
Min temp (night)3.20 °C 3.20–16.8
Precipitation42.3 mm/mo 17.7–42.3
Air humidity54.3 % 43.4–54.3
Moisture balance-49.4 mm/mo -158–-49.4
Vapour deficit708 Pa 708–1,878
Wind speed2.70 m/s 2.70–3.70
Cloud cover34.3 % 34.3–37.9
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.