Anchistus miersi

(De Man, 1888) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Palaemonidae/Anchistus

At a glance

Occurrence records89

Data sources6

Biological traits4

DNA specimens7

eDNA detections8

Sources6 archives

Databases and archives Anchistus miersi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

OBISOcean Biodiversity Information System25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS89 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anchistus miersi is een garnalensoort uit de familie van de Palaemonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1888 door De Man.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max34 m

Depth min0 m

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchistus miersi has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P626 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

89Cmostly conserved

137Cvariable

149Gmostly conserved

155Gvariable

170Cvariable

242Cmostly conserved

443Cvariable

479Tvariable

542Amostly conserved

560Tmostly conserved

TAGTAGGAACTTCTCTTAGGCTTCTAATTCGAGCTGAATTAGGGCAGCCTGGAAGTCTTATTGGAAACGATCAAATCTATAATGTTATCG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes5

BIN1

Most divergent pair1.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anchistus australissame genus8.5%Paranchistus ornatussame family15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type89 records

Wild obs. + sensor12

Museum / vouchered74

Other3

Range

Area of Occupancy AOO144 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 22.5 m · max 22.5 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤1 km 1>10 km 3

4 georeferenced · 8 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤1 km 16>10 km 6

22 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum and Art Gallery of the Northern Territorylocation not on record	19
Kitakyushu Museum of Natural History and Human Historylocation not on record	8
Washington, US	7
Brussels, BE	6
RBINS-Scientific Heritagelocation not on record	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Natick, US	3
Sydney, AU	3
Stockholm, SE	1
University of Floridalocation not on record	1
Western Australian Museumlocation not on record	1

11 institutions · 58 of 74 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Anchistus miersi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–24.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)24.8 °C

Min temp (night)23.4 °C

Precipitation231 mm/mo

Air humidity69.8 %

Moisture balance54.4 mm/mo

Vapour deficit904 Pa

Wind speed3.80 m/s

Cloud cover29.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)