Anchiale austrotessulata

Brock & Hasenpusch, 2007 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Phasmida/Phasmatidae/Anchiale

At a glance

Occurrence records2 239

Data sources10

Biological traits0

DNA specimens11

eDNA detections11

Sources10 archives

Databases and archives Anchiale austrotessulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 239 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT2n = 38

01Narrative

Anchiale austrotessulata (synonyms include Ctenomorphodes tessulatus), the tessellated stick insect, tessellated phasmid or tessulata stick insect, is a medium-sized, stick insect found in the Brisbane area of Australia.Phasmid Study Group: Anchiale austrotessulata Fully grown males in mating season exhibit frenetic behaviour. This species is also parthenogenetic. The species was first described in 1835 by George Robert Gray as Ctenomorphodes tessulata (later corrected to tessulatus).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchiale austrotessulata has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes2

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

13Tvariable

31Tvariable

34Avariable

64Cvariable

124Amostly conserved

130Amostly conserved

157Tvariable

184Gvariable

211Gvariable

214Cvariable

217Gvariable

287Cvariable

289Amostly conserved

307Tmostly conserved

316Tmostly conserved

328Tvariable

355Avariable

373Avariable

406Cvariable

472Avariable

514Cvariable

589Tvariable

592Avariable

595Cvariable

604Cmostly conserved

607Cvariable

616Tvariable

631Amostly conserved

646Tmostly conserved

GACTCTATATTTTTTCCTTGGGATTTGATCTGGAATAATTGGTCTATCTATAAGAATAATTATCCGAATAGAATTAGGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes5

BINs2

Most divergent pair3.6%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anchiale briareussame genus10.8%Clitarchus tepakisame family12.8%Acrophylla wuelfingisame family13.2%Candovia annulatasame order13.9%Parapodacanthus hasenpuschorumsame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anchiale austrotessulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 371×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 381×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 239 records

Wild obs. + sensor2 221

Museum / vouchered18

Range

Area of Occupancy AOO3 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 152≤1 km 304≤10 km 77>10 km 210

1 743 georeferenced · 478 without coordinates

Open the mapobservation + sensor2 221

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2≤10 km 3>10 km 1

6 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	6
QVMAGlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1

3 institutions · 9 of 18 vouchered records shown · 9 without an institution code

09Environmental DNA11 detections

Where the DNA of Anchiale austrotessulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 22.1–22.2

Seasonal swing summer↔winter11.0 °C

Max temp (day)28.0 °C 23.6–28.0

Min temp (night)16.8 °C 16.8–20.5

Precipitation85.7 mm/mo 85.7–119

Air humidity57.3 % 57.3–59.8

Moisture balance-69.5 mm/mo -75.9–-69.5

Vapour deficit1,141 Pa 1,063–1,141

Wind speed2.30 m/s 2.30–5.80

Cloud cover19.5 % 19.5–22.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anchiale austrotessulata

At a glance

Sources10 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 239 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 239 records