Ancherythroculter kurematsui

(Kimura, 1934) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Ancherythroculter

At a glance

Occurrence records0

Data sources6

Biological traits4

DNA specimens6

eDNA detections5

Sources6 archives

Databases and archives Ancherythroculter kurematsui's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Ancherythroculter kurematsui is a species of cyprinid in the genus Ancherythroculter. It is native to the Yangtze in China, and was described in 1934. Named in honor of U. Kurematsu, Japanese General Council of Chengtu (now Chingdu), capital of Sichuan Province, China, where it occurs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length22 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability12

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancherythroculter kurematsui has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

15Cmostly conserved

69Tmostly conserved

87Cmostly conserved

150Amostly conserved

183Gmostly conserved

186Amostly conserved

219Gmostly conserved

249Cmostly conserved

255Gmostly conserved

256Tmostly conserved

273Tmostly conserved

276Gmostly conserved

279Tmostly conserved

282Amostly conserved

288Amostly conserved

303Cmostly conserved

336Gmostly conserved

339Gmostly conserved

375Gmostly conserved

384Gmostly conserved

393Cmostly conserved

429Cmostly conserved

447Tmostly conserved

465Tmostly conserved

480Tmostly conserved

483Gmostly conserved

508Cmostly conserved

510Gmostly conserved

513Cvariable

516Gmostly conserved

531Tmostly conserved

543Amostly conserved

546Cmostly conserved

558Tmostly conserved

579Cmostly conserved

585Gmostly conserved

603Gmostly conserved

607Tmostly conserved

ATAGTGGGAACCGCCCTAAGCCTTCTCATTCGAGCCGAACTAAGCCAACCTGGATCACTTCTGGGCGATGACCAAATTTATAATGTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes3

BINs2

Most divergent pair6.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Culter oxycephaloidessame family3.8%Chanodichthys dabryisame family4.6%Culter alburnussame family4.7%Chanodichthys erythropterussame family5.0%Ancherythroculter nigrocaudasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_029707 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

09Environmental DNA5 detections

Where the DNA of Ancherythroculter kurematsui was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)