Anchastus binus

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Anchastus

At a glance

Occurrence records112

Data sources6

Biological traits0

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Anchastus binus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF112 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Anchastus binus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1839 door Say.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchastus binus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

112Cvariable

115Tmostly conserved

166Amostly conserved

199Gmostly conserved

212Cvariable

217Tvariable

271Amostly conserved

283Amostly conserved

289Cvariable

322Avariable

352Amostly conserved

361Tmostly conserved

373Cmostly conserved

421Amostly conserved

433Tmostly conserved

454Cmostly conserved

456Tmostly conserved

469Amostly conserved

523Cvariable

529Cvariable

541Tmostly conserved

616Tmostly conserved

637Tmostly conserved

646Cmostly conserved

AACATTATATTTCCTATTTGGAGCCTGAGCTGGGATACTAGGAACATCATTAAGATTATTAATCCGAGCTGAACTTGGCAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BIN1

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Quasimus minutissimussame family14.0%Monocrepidius lividussame family14.7%Parasilesis musculussame family14.9%Sclerotia fuisame order15.0%Hypnoidus rivalissame family15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type112 records

Wild obs. + sensor95

Museum / vouchered17

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 47≤1 km 19≤10 km 4>10 km 6

76 georeferenced · 19 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Central Floridalocation not on record	9
College Station, US	6
University Park, US	1
Lake Placid, US	1

4 institutions · 17 of 17 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Anchastus binus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 23.8–25.7

Seasonal swing summer↔winter10.5 °C

Max temp (day)31.2 °C 29.4–31.2

Min temp (night)20.4 °C 18.8–20.4

Precipitation94.7 mm/mo 94.7–98.4

Air humidity56.9 % 56.9–58.4

Moisture balance-75.5 mm/mo -75.5–-62.4

Vapour deficit1,413 Pa 1,226–1,413

Wind speed2.60 m/s 2.00–2.60

Cloud cover29.0 % 29.0–36.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)