Anaxipha exigua

(Say, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Trigonidiidae/Anaxipha

At a glance

Occurrence records1 232

Data sources8

Biological traits0

DNA specimens24

eDNA detections9

Sources8 archives

Databases and archives Anaxipha exigua's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 232 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 232 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD24 specimens

01Narrative

Anaxipha exigua is a cricket in the genus Anaxipha ("brown trigs"), in the subfamily Trigonidiinae ("winged bush crickets, trigs").bugguide.net Anaxipha exigua species information.Integrated Taxonomic Information System (ITIS) Common names are "Say's trig" and "Say's bush cricket".Singing Insects of North AmericaEncyclopedia of Life Anaxipha exigua species overview. The distribution range of Anaxipha exigua includes the Caribbean and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaxipha exigua has left across the world's sequence archives.

At a glance

DNA specimens24

BINs4

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 79 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

21Gmostly conserved

22Avariable

23Gmostly conserved

24Cmostly conserved

25Cmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Avariable

35Amostly conserved

39Tmostly conserved

40Avariable

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

48Cmostly conserved

49Avariable

50Tmostly conserved

51Tmostly conserved

54Gmostly conserved

56Amostly conserved

59Cmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tmostly conserved

68Tmostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Tmostly conserved

81Amostly conserved

82Amostly conserved

85Tmostly conserved

103Cmostly conserved

202Tvariable

214Tmostly conserved

229Avariable

262Avariable

271Cvariable

301Gvariable

355Amostly conserved

373Gvariable

394Tmostly conserved

418Cvariable

439Cvariable

478Avariable

505Tmostly conserved

535Tmostly conserved

542Tvariable

547Cmostly conserved

574Cvariable

577Avariable

583Amostly conserved

628Gvariable

AACTTTATATTTTATTTTTGGAGCCTGATCTGGAATAGTAGGAACATCATTAAGAATACTAATTCGTTTAGAATTAGGTCAACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes13

BINs4

Most divergent pair3.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaxipha sciasame genus5.8%Anaxipha litarenasame genus9.4%Anaxipha vernalissame genus9.4%Anaxipha delicatulasame genus9.7%Anaxipha tinnulasame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 232 records

Wild obs. + sensor1 030

Museum / vouchered202

Origin

Native2

Range

Area of Occupancy AOO3 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 503≤1 km 167≤10 km 74>10 km 133

877 georeferenced · 153 without coordinates

Open the mapobservation + sensor1 030

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 10≤1 km 55≤10 km 44>10 km 1

110 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	99
University of Guelphlocation not on record	41
	18
Provo, US	9
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
Wuzhou, CN	6
CUlocation not on record	6
Montgomery, US	2
University of Central Floridalocation not on record	1

9 institutions · 189 of 202 vouchered records shown · 13 without an institution code

09Environmental DNA9 detections

Where the DNA of Anaxipha exigua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 18.4–23.5

Seasonal swing summer↔winter26.2 °C

Max temp (day)25.5 °C 21.1–27.5

Min temp (night)20.4 °C 14.9–20.9

Precipitation91.2 mm/mo 84.6–97.3

Air humidity59.0 % 58.4–59.3

Moisture balance-65.6 mm/mo -74.8–-39.1

Vapour deficit1,141 Pa 903–1,176

Wind speed2.70 m/s 2.50–6.20

Cloud cover37.9 % 34.6–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaxipha exigua

At a glance

Sources8 archives

At a glance

Record type1 232 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 232 records