Anaxidia lozogramma

(Turner, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Limacodidae/Anaxidia

At a glance

Occurrence records620

Data sources7

Biological traits0

DNA specimens12

eDNA detections10

Sources7 archives

Databases and archives Anaxidia lozogramma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility620 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF620 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD12 specimens

01Narrative

Anaxidia lozogramma is a moth of the family Limacodidae found in Australia, in coastal and subcoastal areas from the Atherton tableland to Eungella in northern Queensland and from southern Queensland to Mount Keira in New South Wales. The larvae feed on the foliage of Macadamia, Dodonaea triquetra and Camellia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaxidia lozogramma has left across the world's sequence archives.

At a glance

DNA specimens12

BINs4

Marker genes2

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 70 variable positions, in barcode order

19Cmostly conserved

34Amostly conserved

46Tmostly conserved

49Tmostly conserved

55Amostly conserved

56Tmostly conserved

61Tmostly conserved

70Tmostly conserved

82Cmostly conserved

85Amostly conserved

92Tmostly conserved

100Amostly conserved

101Gmostly conserved

118Tmostly conserved

124Cmostly conserved

133Tmostly conserved

139Tmostly conserved

157Tmostly conserved

160Amostly conserved

169Tmostly conserved

181Amostly conserved

193Tmostly conserved

202Cmostly conserved

205Tmostly conserved

214Amostly conserved

217Tmostly conserved

220Gmostly conserved

235Cmostly conserved

271Tmostly conserved

274Tmostly conserved

277Tmostly conserved

278Cvariable

281Amostly conserved

284Tmostly conserved

286Amostly conserved

292Tmostly conserved

295Gmostly conserved

307Tmostly conserved

340Cmostly conserved

346Tvariable

364Tmostly conserved

376Amostly conserved

400Tmostly conserved

421Amostly conserved

433Tmostly conserved

436Cmostly conserved

448Tmostly conserved

451Tmostly conserved

457Tmostly conserved

469Tmostly conserved

472Tmostly conserved

475Tmostly conserved

505Tmostly conserved

529Tmostly conserved

530Tmostly conserved

542Tmostly conserved

547Cmostly conserved

556Tmostly conserved

562Tmostly conserved

565Tmostly conserved

574Amostly conserved

580Tmostly conserved

583Tmostly conserved

586Amostly conserved

604Tmostly conserved

610Tmostly conserved

616Tmostly conserved

631Tmostly conserved

652Tmostly conserved

658Tvariable

AACTTTATATTTTATTTTCGGAATTTGATCAGGAATAGTAGGAACTTCTTTAAGATTACTTATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes6

BINs3

Most divergent pair8.5%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phocoderma velutinasame family7.0%Phocoderma betissame family7.1%Hyphorma minaxsame family7.3%Miresa bracteatasame family7.4%Miresa demangeisame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type620 records

Wild obs. + sensor612

Museum / vouchered8

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 294≤1 km 180≤10 km 21>10 km 35

530 georeferenced · 82 without coordinates

Open the mapobservation + sensor612

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	4
Tallinn, EE	1
Australian National Insect Collectionlocation not on record	1

3 institutions · 6 of 8 vouchered records shown · 2 without an institution code

09Environmental DNA10 detections

Where the DNA of Anaxidia lozogramma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 23.4–24.5

Seasonal swing summer↔winter11.1 °C

Max temp (day)29.4 °C 27.2–29.4

Min temp (night)19.7 °C 18.5–20.5

Precipitation117 mm/mo 77.8–202

Air humidity60.5 % 56.3–62.3

Moisture balance-33.8 mm/mo -105–44.5

Vapour deficit1,284 Pa 1,073–1,291

Wind speed3.80 m/s 2.30–3.90

Cloud cover30.8 % 29.1–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)