Anaxeton arborescens

(L.) Less. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Anaxeton

At a glance

Occurrence records571

Data sources8

Biological traits10

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Anaxeton arborescens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility571 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF571 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Anaxeton arborescens là một loài thực vật có hoa trong họ Cúc. Loài này được (L.) Less. mô tả khoa học đầu tiên năm 1832.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Plant height max0.44 m

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max1 100 m

Elevation min700 m

Epiphyteterrestrial

Growth formherb

Woodinesswoody

03Chemical composition8 compounds

Compounds documented for Anaxeton arborescens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Furocoumarins $ Simple coumarins1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,6R,8R,9S,10S,11R,12S,13R,16R,18S)-10-hydroxy-2-(2-methoxypropan-2-yl)-16-(2-methylprop-1-enyl)-7,14,15-trioxahexacyclo[9.5.2.01,12.04,18.06,8.09,13]octadec-3-ene-5,17-dione	present	NPASS
FZFOYVPJRYSIMY-UDOVHQHDSA-N	present	NPASS
Obliquin	present	LOTUS
Panepophenanthrin	present	NPASS
Panepoxydione	present	NPASS
WYTBEDBPRKCHGY-QWRGUYRKSA-N	present	NPASS
WYTBEDBPRKCHGY-WDEREUQCSA-N	present	NPASS
XNQYNBDARWOHSB-ZRUFSTJUSA-N	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaxeton arborescens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLAM234847.1 ↗1 399 bp

ACGT

TGTTGGATTCAAAGCAGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATT …

Anaxeton arborescens chloroplast partial rbcL gene for ribulose bisphosphate carboxylase large subunit, specimen voucher Balele K. 9b (NBG)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type571 records

Wild obs. + sensor545

Museum / vouchered26

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 427≤1 km 43≤10 km 18>10 km 1

489 georeferenced · 56 without coordinates

Open the mapobservation + sensor545

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	17
Cape Town, ZA	3
Zürich, CH	2
MeiseBGlocation not on record	2
Saint Louis, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

6 institutions · 26 of 26 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Anaxeton arborescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)