Anax walsinghami

McLachlan, 1883 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Aeshnidae/Anax

At a glance

Occurrence records617

Data sources8

Biological traits0

DNA specimens11

eDNA detections6

Sources8 archives

Databases and archives Anax walsinghami's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility617 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF617 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD11 specimens

01Narrative

Anax walsinghami is a species of dragonfly in the family Aeshnidae (darners), in the suborder Anisoptera ("dragonflies"). The species is known generally as the giant darner or giant green darner. The distribution range of Anax walsinghami includes Central America and North America. The IUCN conservation status of A. walsinghami is least concern, with no immediate threat to the species' survival. The population is stable.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anax walsinghami has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P778 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

297Gmostly conserved

351Tmostly conserved

363Tvariable

414Amostly conserved

TCACATATTATTGCACAAGAAAGAGGAAAAAAGGAAACATTTGGTCTCTTAGGTATAATTTATGCTATGGTAGCAATTGGAATTTTAGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes3

BINs0

Most divergent pair0.51%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anax concolorsame genus10.4%Trechus saxicolasame order14.3%Trechus riberaisame order15.1%Orotrechus vicentinussame order15.8%Trechus croceussame order15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type617 records

Wild obs. + sensor427

Museum / vouchered190

Range

Area of Occupancy AOO1 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 130≤1 km 44≤10 km 5>10 km 5

184 georeferenced · 243 without coordinates

Open the mapobservation + sensor427

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 22≤1 km 17≤10 km 18>10 km 3

60 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence190

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	63
Cornell University Insect Collectionlocation not on record	42
Mexico City, MX	12
Washington, US	8
Essig Museum of Entomologylocation not on record	5
San Francisco, US	4
University Park, US	4
CASlocation not on record	3
Durango, MX	3
UCBMElocation not on record	2
Juriquilla, MX	2
Champaign, US	2
Philadelphia, US	1
San Luis Potosí, MX	1
Toronto, CA	1

15 institutions · 153 of 190 vouchered records shown · 36 without an institution code

09Environmental DNA6 detections

Where the DNA of Anax walsinghami was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 13.1–13.1

Seasonal swing summer↔winter19.2 °C

Max temp (day)18.5 °C

Min temp (night)8.50 °C

Precipitation87.2 mm/mo

Air humidity53.9 %

Moisture balance28.4 mm/mo

Vapour deficit695 Pa

Wind speed2.90 m/s

Cloud cover56.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)