Anax longipes

Hagen, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Aeshnidae/Anax

At a glance

Occurrence records3 166

Data sources10

Biological traits0

DNA specimens12

eDNA detections4

Sources10 archives

Databases and archives Anax longipes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 166 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 166 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT · TreeOfSex2n = 28

01Narrative

The comet darner (Anax longipes) is a common species of dragonfly of the family Aeshnidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anax longipes has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes3

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P612 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)4.2%

Haplotypes2

BINs2

Most divergent pair9.5%

Where individuals differ — all 60 variable positions, in barcode order

2Cmostly conserved

3Cvariable

12Tmostly conserved

13Tmostly conserved

93Amostly conserved

108Tmostly conserved

117Tmostly conserved

156Amostly conserved

160Tmostly conserved

186Amostly conserved

189Tmostly conserved

196Amostly conserved

204Cmostly conserved

216Amostly conserved

220Cmostly conserved

222Tmostly conserved

228Cmostly conserved

232Amostly conserved

237Tmostly conserved

238Tmostly conserved

240Amostly conserved

246Gmostly conserved

255Amostly conserved

270Amostly conserved

291Gmostly conserved

312Amostly conserved

318Amostly conserved

327Tmostly conserved

333Amostly conserved

345Amostly conserved

348Cmostly conserved

355Tmostly conserved

357Gmostly conserved

360Tmostly conserved

361Cmostly conserved

363Tmostly conserved

369Amostly conserved

370Amostly conserved

372Tmostly conserved

375Amostly conserved

423Amostly conserved

432Amostly conserved

438Gmostly conserved

453Tmostly conserved

454Cmostly conserved

468Tmostly conserved

472Amostly conserved

474Gmostly conserved

483Cmostly conserved

487Cmostly conserved

489Tmostly conserved

493Cmostly conserved

501Amostly conserved

502Tmostly conserved

504Amostly conserved

558Tmostly conserved

573Avariable

585Avariable

588Cvariable

606Cvariable

GCCCTAAGAGTTTTAATTCGAATTGAATTAGGACAACCAGGATCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACAGCTCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anax imperatorsame genus8.5%Anax nigrofasciatussame genus8.9%Anax parthenopesame genus9.0%Anax immaculifronssame genus9.2%Anax speratussame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS1

animal barcodefungal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anax longipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records28–282n range28median28mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Cruden RW (1968) Chromosome numbers of some North American dragonflies (Odonata). Canadian Journal of Genetics and Cytology 10: 200-214. ↗

2n 272×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type3 166 records

Wild obs. + sensor2 934

Museum / vouchered232

Range

Area of Occupancy AOO5 416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 881≤1 km 329≤10 km 59>10 km 215

1 484 georeferenced · 1 450 without coordinates

Open the mapobservation + sensor2 934

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 8≤1 km 25≤10 km 11>10 km 3

47 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence232

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	93
Washington, US	25
Philadelphia, US	14
University Park, US	11
Wuzhou, CN	10
Cornell University Insect Collectionlocation not on record	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
East Lansing, US	4
Champaign, US	3
Chicago, US	1
OSUClocation not on record	1
Montgomery, US	1
Mayagüez, PR	1
University of Central Floridalocation not on record	1

14 institutions · 178 of 232 vouchered records shown · 54 without an institution code

09Environmental DNA4 detections

Where the DNA of Anax longipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anax longipes

At a glance

Sources10 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 166 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 166 records