Anax amazili

(Burmeister, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Aeshnidae/Anax

At a glance

Occurrence records815

Data sources7

Biological traits0

DNA specimens15

eDNA detections15

Sources7 archives

Databases and archives Anax amazili's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility815 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF815 records

Environmental DNA1 datasets · 5 countries15 detections

DNA & barcodingBOLD15 specimens

01Narrative

Anax amazili, the Amazon darner, is a tropical species of dragonfly of the family Aeshnidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anax amazili has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections15

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.51%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 6 variable positions, in barcode order

385Cvariable

407Tmostly conserved

412Tmostly conserved

478Amostly conserved

610Cmostly conserved

646Tvariable

AACACTTTATTTTTTATTTGGAGCATGATCAGGAATGGTAGGAACTGCTCTAAGAGTTCTAATTCGAATTGAATTAGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anax juniussame genus6.7%Anax tristissame genus6.7%Aeshna constrictasame family6.8%Anax parthenopesame genus7.0%Anax imperatorsame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type815 records

Wild obs. + sensor694

Museum / vouchered121

Origin

Native1

Range

Area of Occupancy AOO2 212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 304≤1 km 91≤10 km 56>10 km 35

486 georeferenced · 208 without coordinates

Open the mapobservation + sensor694

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 34≤1 km 1≤10 km 19>10 km 5

59 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	23
Washington, US	19
IBNlocation not on record	11
National Biodiversity Institute, Costa Ricalocation not on record	11
Odonata Centrallocation not on record	3
Cornell University Insect Collectionlocation not on record	3
Universidad de La Salle (La Salle)location not on record	3
Mayagüez, PR	3
New Haven, US	2
The University of the West Indies, Trinidad and Tobagolocation not on record	2
Bonn, DE	2
Montréal, CA	2
University Park, US	2
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	2
San Luis Potosí, MX	1
Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record	1
Champaign, US	1

17 institutions · 91 of 121 vouchered records shown · 27 without an institution code

09Environmental DNA15 detections

Where the DNA of Anax amazili was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map5 countries0

Bosque Seco Tropical1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 20.0–26.9

Seasonal swing summer↔winter2.60 °C

Max temp (day)28.2 °C 24.0–32.0

Min temp (night)22.5 °C 16.6–23.5

Precipitation128 mm/mo 49.0–366

Air humidity62.9 % 58.2–69.4

Moisture balance3.90 mm/mo -87.7–251

Vapour deficit1,066 Pa 682–1,485

Wind speed2.50 m/s 1.40–4.20

Cloud cover44.1 % 13.7–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)