Anatralata versicolor

Warren, 1892 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anatralata

At a glance

Occurrence records31

Data sources7

Biological traits0

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Anatralata versicolor's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Anatralata is a genus of moths of the family Crambidae. It contains only one species, Anatralata versicolor, which is found in North America, where it has been recorded from Californiamothphotographersgroup to Idaho and British Columbia. The habitat consists of mountainous areas and low-elevation grasslands along the coast of central California. The length of the forewings is 5–7 mm. The forewings are chestnut-brown with black scales, but pale whitish green scales in the basal third and subterminal area. The hindwings are black fuscous, with pale green scales along the inner margin. Adults are on wing from March to July. The larvae feed on Wyethia angustifolia.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anatralata versicolor has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

83Amostly conserved

CTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACATCTCTTAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGTTCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atralata albofascialissame family5.6%Cymbopteryx unilinealissame family6.3%Frechinia helianthialessame family6.6%Chrismania pictipennalissame family6.9%Tegostoma lepidalissame family6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor21

Museum / vouchered10

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 6≤1 km 3≤10 km 2>10 km 2

13 georeferenced · 8 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 1≤10 km 2>10 km 6

10 georeferenced

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	6
San Francisco, US	3
Essig Museum of Entomologylocation not on record	1

3 institutions · 10 of 10 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Anatralata versicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 13.2–16.5

Seasonal swing summer↔winter25.5 °C

Max temp (day)20.2 °C 20.2–22.6

Min temp (night)5.90 °C 5.90–11.0

Precipitation84.0 mm/mo 84.0–119

Air humidity51.3 % 51.3–55.6

Moisture balance-51.0 mm/mo -51.0–-36.7

Vapour deficit747 Pa 747–835

Wind speed2.90 m/s 2.90–5.00

Cloud cover39.3 % 38.5–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)