Anatrachyntis simplex

(Walsingham, 1891) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Cosmopterigidae/Anatrachyntis

At a glance

Occurrence records13

Data sources7

Biological traits0

DNA specimens9

eDNA detections126

Sources7 archives

Databases and archives Anatrachyntis simplex's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI126 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF13 records

Environmental DNA2 datasets · 11 countries126 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anatrachyntis simplex Anatrachyntis simplex is a moth in the family Cosmopterigidae. It is found on Egypt, La Réunion, Gambia and the United Arab Emirates, Cyprus, Morocco, Portugal, Spain,Afro moths India and China. It is recorded infrequently in Great Britain through accidental importation in pomegranates.Hants Moths The wingspan is about 10 mm. In Europe, adults have been recorded in August and October. In the tropics there are multiple generations per year. The larvae feed within the fruit of pomegranates. In Africa they have also been recorded feeding on Elaeis guineensis (African oil palm) (Arecaceae), Zea mays (Poaceae), Gossypium sp. and Ceiba pentandra (Malvaceae), as well as flowers of Pandanus sp.Gates Clarke, 1971. The Lepidoptera of Rapa Island. Smithonian Contributions to Zoology, 56. and Typha domingensis (Typhaceae)Bippus,_M. 2020b. Records of Lepidoptera from the Malagasy region with description of new species (Lepidoptera: Tortricidae, Noctuidae, Alucitidae, Choreutidae, Euteliidae, Gelechiidae, Blastobasidae, Pterophoridae, Tonzidae, Tineidae, Praydidae, Cosmopterigidae, Batrachedridae). - Phelsuma 28: 60-100.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anatrachyntis simplex has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections126

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

1Amostly conserved

4Tmostly conserved

52Tmostly conserved

67Amostly conserved

100Amostly conserved

103Tvariable

160Amostly conserved

166Avariable

212Cvariable

217Amostly conserved

235Cmostly conserved

271Cmostly conserved

274Tmostly conserved

403Amostly conserved

428Tmostly conserved

433Tmostly conserved

529Cmostly conserved

550Avariable

604Tvariable

607Tvariable

616Cmostly conserved

619Tmostly conserved

628Avariable

634Tmostly conserved

640Tvariable

641Cvariable

646Tvariable

658Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTCTTAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BIN1

Most divergent pair2.7%

AfricaN.AmericaEuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Labdia cyanogrammasame family7.8%Stenhypena albopunctatasame order8.2%Mecodina diastrigasame order9.0%Gnamptonyx innexasame order9.1%Matigramma pulverilineasame order9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor5

Museum / vouchered8

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤1 km 2>10 km 3

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	4
Naturalis Biodiversity Centerlocation not on record	1

2 institutions · 5 of 8 vouchered records shown · 3 without an institution code

09Environmental DNA126 detections

Where the DNA of Anatrachyntis simplex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found126

Studies independent surveys2

Countries11

Verifiable raw sequence linked11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 126 detections have coordinates

Open the map11 countries0

14. Artificial - Terrestrial8. Desert | 8.1. Hot DesertKnob Thorn/MarulaÂ Savannah3. Shrubland|3.5. Subtropical/Tropical Dry S…3. Shrubland | 3.5. Subtropical/Tropical Dry…2. Savanna | 2.1. Dry Savanna

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 21.6–30.1

Seasonal swing summer↔winter12.7 °C

Max temp (day)29.5 °C 26.8–35.9

Min temp (night)21.1 °C 15.2–23.4

Precipitation3.70 mm/mo 0.6–62.5

Air humidity57.9 % 45.0–60.2

Moisture balance-151 mm/mo -160–-75.4

Vapour deficit1,303 Pa 1,218–2,182

Wind speed3.30 m/s 1.80–3.80

Cloud cover12.8 % 6.40–27.3

CHELSA 1981–2010, ~9 km grid, at location & month of 123 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)