Anatoecus dentatus

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Psocodea/Philopteridae/Anatoecus

At a glance

Occurrence records100

Data sources6

Biological traits0

DNA specimens80

eDNA detections77

Sources6 archives

Databases and archives Anatoecus dentatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics80 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF100 records

Environmental DNA1 datasets · 4 countries77 detections

DNA & barcodingBOLD80 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding80 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anatoecus dentatus has left across the world's sequence archives.

At a glance

DNA specimens80

BINs2

Marker genes2

eDNA detections77

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P519 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

3Gmostly conserved

6Amostly conserved

12Gmostly conserved

21Cmostly conserved

37Gmostly conserved

42Amostly conserved

44Cmostly conserved

75Tmostly conserved

81Amostly conserved

156Tmostly conserved

204Cmostly conserved

363Gmostly conserved

483Tmostly conserved

489Gmostly conserved

495Tmostly conserved

501Amostly conserved

510Amostly conserved

513Amostly conserved

GGGATAAGAATGATTATTCGCTTTGAATTAGGAGAAGCTGGATCATTTATTATTGATTCTCATATTTATAATGTTATTGTAACTTCTCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes6

BINs2

Most divergent pair10.6%

N.AmericaAsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anatoecus penicillatussame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_069918 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ND4ATP8ATP6ND5ND6CYTBCOX2ND2COX3ND1ND3ND4L12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type100 records

Wild obs. + sensor3

Museum / vouchered97

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 1≤10 km 34

35 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	16
NHMOlocation not on record	16
Stockholm, SE	5
Cambridge, US	3
University of New Hampshirelocation not on record	3
KwaZulu-Natal Museumlocation not on record	2
QVMAGlocation not on record	2
Harold Winfred Manter Laboratory of Parasitologylocation not on record	1
Washington, US	1

9 institutions · 49 of 97 vouchered records shown · 18 without an institution code

09Environmental DNA77 detections

Where the DNA of Anatoecus dentatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-4.40 °C -4.40–5.70

Seasonal swing summer↔winter41.0 °C

Max temp (day)-1.10 °C -1.10–9.20

Min temp (night)-6.50 °C -6.50–1.40

Precipitation54.0 mm/mo 54.0–130

Air humidity65.1 % 62.6–65.1

Moisture balance-1.80 mm/mo -1.80–54.3

Vapour deficit269 Pa 269–357

Wind speed5.60 m/s 5.60–5.90

Cloud cover57.6 % 38.9–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)