Anathallis ourobranquensis

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Anathallis

At a glance

Occurrence records1

Data sources5

Biological traits7

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Anathallis ourobranquensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF1 records

DNA & barcodingNCBIsequences

01Narrative

Anathallis ourobranquensis is a species of orchid.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Estacional Decidual

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anathallis ourobranquensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSJQ306459.1 ↗786 bp

ACGT

GGTGAAGTGTTCGGATCGCTGTGATGCGGGCGGTTCGCCGCCCGTGACTCTGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAG …

Anathallis ourobranquensis voucher GC11220 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Origin

Native1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

10Collections & institutions

Institution	Specimens
UFMGlocation not on record	1

1 institutions · 1 of 1 vouchered records shown