Anathallis linearifolia

(Cogn.) Pridgeon & M.W.Chase · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Anathallis

At a glance

Occurrence records83

Data sources7

Biological traits12

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Anathallis linearifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF83 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Anathallis linearifolia is a species of orchid.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 600 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anathallis linearifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN332352.1 ↗765 bpBrazil

ACGT

CCCGTGACTCTGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGA …

Anathallis linearifolia voucher E.C. Smidt 1012 (UPCB) 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type83 records

Wild obs. + sensor3

Museum / vouchered80

Origin

Native31

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1>10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 80 records without

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	22
Stockholm, SE	10
San Jose State University, Museum of Birds and Mammalslocation not on record	8
Bronx, US	7
INMAlocation not on record	6
Chicago, US	5
Pontifícia Universidade Católica do Paranálocation not on record	3
UNESP-RClocation not on record	3
Maringá, BR	2
UFSCarlocation not on record	2
FUVATESlocation not on record	2
UFPRlocation not on record	2
UFESlocation not on record	1
Campo Mourão, BR	1
UFBAlocation not on record	1
Ivano-Frankivsk, UA	1
Salvador, BR	1
UNICAMPlocation not on record	1
Cascavel, BR	1
UTFPR-CPlocation not on record	1

20 institutions · 80 of 80 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Anathallis linearifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)