Anathallis brevipes — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Anathallis

At a glance

Occurrence records15

Data sources6

Biological traits13

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Anathallis brevipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF15 records

DNA & barcodingNCBIsequences

01Narrative

Anathallis brevipes is a species of orchid plant native to Guyana.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max800 m

Elevation mean300 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTCampinarana, Floresta de Terra Firme, Floresta de Várzea, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anathallis brevipes has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN332335.1 ↗874 bpBrazil

ACGT

TCGGTGAAGTGTTCGGATCGCTGTGATGCGGGCGGTTCGCCGCCCGTGACTCTGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGG …

Anathallis brevipes voucher A.L.V. Toscano de Brito 3459 (UPCB) 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor4

Museum / vouchered11

Origin

Native5

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Maringá, BR	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Bronx, US	1
UEMlocation not on record	1
UFPRlocation not on record	1
UNESP-RClocation not on record	1
UTFPR-CPlocation not on record	1
UFMGlocation not on record	1

8 institutions · 10 of 11 vouchered records shown · 1 without an institution code