Anastrepha striata

Schiner, 1868 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Anastrepha

At a glance

Occurrence records563

Data sources8

Biological traits0

DNA specimens109

eDNA detections118

Sources8 archives

Databases and archives Anastrepha striata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility563 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI118 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics109 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF563 records

Environmental DNA1 datasets · 10 countries118 detections

DNA & barcodingBOLD109 specimens

Genome at a glanceGoaT · TreeOfSex2n = 12

01Narrative

Anastrepha striata is een vliegensoort uit de familie van de boorvliegen (Tephritidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1868 door Ignaz Rudolph Schiner, in zijn rapport over de tweevleugeligen verzameld tijdens de Novara-expeditie van 1857-1859.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding109 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastrepha striata has left across the world's sequence archives.

At a glance

DNA specimens109

BINs3

Marker genes2

eDNA detections118

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus100 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

56Amostly conserved

58Cmostly conserved

59Cmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Amostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

79Tmostly conserved

81Amostly conserved

82Cmostly conserved

83Cmostly conserved

84Cmostly conserved

87Gmostly conserved

88Amostly conserved

89Gmostly conserved

90Cmostly conserved

91Cmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Amostly conserved

115Cmostly conserved

133Amostly conserved

217Gmostly conserved

433Gmostly conserved

436Gmostly conserved

547Cmostly conserved

619Tmostly conserved

AACACTATATTTTATTTTTGGAGCATGAGCTGGTATAGTAGGAACATCTCTTAGAATCCTAATTCGAACTGAATTAGGTCACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes10

BINs3

Most divergent pair6.7%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anastrepha bistrigatasame genus1.8%Anastrepha distinctasame genus6.2%Anastrepha sororculasame genus6.4%Anastrepha bahiensissame genus6.5%Anastrepha zacharyisame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_071718 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anastrepha striata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1210×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Frias, L. (1992). "Some Aspects of the Evolutive Biology of Chilean Species of Tephritidae (Diptera)." Acta Entomologica Chilena 17: 69-77. ↗

TreeOfSex · invert — Jan, K. (1967). Cytotaxonomical Studies of Some Schizophorous Diptera. Master of Science, McGill University. ↗

TreeOfSex · invert — Selivon, D., A. L. Perondini and L. S. Rocha (2005). "Karyotype Characterization of Anastrepha Fruit Flies (Diptera: Tephritidae)." Neotropical Entomology 34(2): 273-279. ↗

08Occurrence & distribution

Record type563 records

Wild obs. + sensor91

Museum / vouchered472

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 12≤1 km 3≤10 km 2>10 km 4

21 georeferenced · 70 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 470 without coordinates

Open the institutions mapphysical evidence472

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	279
South Kensington, GB	103
Washington, US	15
Museum für Naturkunde Magdeburglocation not on record	6
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	5
The University of the West Indies, Trinidad and Tobagolocation not on record	2
College Station, US	1
Essig Museum of Entomologylocation not on record	1

8 institutions · 412 of 472 vouchered records shown · 56 without an institution code

09Environmental DNA118 detections

Where the DNA of Anastrepha striata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found118

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 118 detections have coordinates

Open the map10 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 19.1–26.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.0 °C 21.6–30.1

Min temp (night)21.2 °C 15.1–22.8

Precipitation324 mm/mo 67.6–795

Air humidity66.8 % 61.9–71.7

Moisture balance185 mm/mo -52.4–659

Vapour deficit1,030 Pa 624–1,233

Wind speed1.00 m/s 0.7–3.00

Cloud cover37.9 % 27.1–66.5

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)