Anastrepha curvicauda

(Gerstaecker, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Anastrepha

At a glance

Occurrence records106

Data sources6

Biological traits0

DNA specimens30

eDNA detections38

Sources6 archives

Databases and archives Anastrepha curvicauda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility106 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF106 records

Environmental DNA1 datasets · 3 countries38 detections

DNA & barcodingBOLD30 specimens

01Narrative

Toxotrypana curvicauda, the papaya fruit fly, is a species of fruit fly in the family Tephritidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastrepha curvicauda has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections38

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P606 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

57Gvariable

75Cmostly conserved

262Gmostly conserved

402Gvariable

462Avariable

516Amostly conserved

GGTATAGTAGGAACTTCACTTAGAATTTTAATTCGAACTGAATTAGGTCATCCAGGGGCTTTAATTGGAGATGACCAAATCTACAATGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes8

BIN1

Most divergent pair0.83%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anastrepha littoralissame genus6.9%Anastrepha recurcaudasame genus7.3%Anastrepha submundasame genus9.9%Anastrepha fuscicaudasame genus10.3%Anastrepha barnesisame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type106 records

Wild obs. + sensor90

Museum / vouchered16

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 43≤1 km 11≤10 km 11>10 km 10

75 georeferenced · 15 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 8

8 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
The University of the West Indies, Trinidad and Tobagolocation not on record	6
ASUlocation not on record	2

2 institutions · 8 of 16 vouchered records shown · 8 without an institution code

09Environmental DNA38 detections

Where the DNA of Anastrepha curvicauda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 20.5–26.2

Seasonal swing summer↔winter1.10 °C

Max temp (day)25.9 °C 23.6–29.0

Min temp (night)19.3 °C 16.6–23.6

Precipitation246 mm/mo 222–281

Air humidity68.5 % 67.8–72.8

Moisture balance147 mm/mo 140–156

Vapour deficit849 Pa 776–935

Wind speed0.9 m/s 0.9–1.60

Cloud cover47.8 % 36.1–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)