Anastrangalia sanguinea

(LeConte, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anastrangalia

At a glance

Occurrence records234

Data sources7

Biological traits0

DNA specimens19

eDNA detections15

Sources7 archives

Databases and archives Anastrangalia sanguinea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility234 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF234 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD19 specimens

01Narrative

Anastrangalia sanguinea is a species of beetle from family Cerambycidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastrangalia sanguinea has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

25Cmostly conserved

85Tvariable

145Gmostly conserved

229Amostly conserved

316Amostly conserved

325Amostly conserved

370Gmostly conserved

394Tmostly conserved

400Gmostly conserved

433Gmostly conserved

436Amostly conserved

466Amostly conserved

491Cmostly conserved

496Amostly conserved

542Cmostly conserved

616Tvariable

619Gmostly conserved

AACTTTATATTTTATTTTTGGAGCCTGGGCAAGAATAGTAGGTACTTCCCTAAGACTTTTAATTCGCTCAGAACTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes10

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anastrangalia sequensisame genus11.9%Tachinus subterraneussame order14.7%Onthophagus hecatesame order15.0%Trirhabda attenuatasame order15.5%Orchesia fasciatasame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type234 records

Wild obs. + sensor130

Museum / vouchered104

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 72≤1 km 19≤10 km 11>10 km 2

104 georeferenced · 26 without coordinates

Open the mapobservation + sensor130

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 2≤1 km 5≤10 km 3>10 km 2

12 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	23
University of Alberta Museums (UAM)location not on record	16
Champaign, US	16
Santa Barbara Museum of Natural Historylocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
WIlocation not on record	6
Royal Saskatchewan Museumlocation not on record	6
University of Central Floridalocation not on record	6
OSUClocation not on record	3
San Diego, US	2
Toronto, CA	2
Edmonton, CA	2
Saint John, CA	2
CUlocation not on record	1
Lubbock, US	1

15 institutions · 98 of 104 vouchered records shown · 6 without an institution code

09Environmental DNA15 detections

Where the DNA of Anastrangalia sanguinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

ForestMixed habitatMixed HabitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 13.0–19.0

Seasonal swing summer↔winter26.1 °C

Max temp (day)22.2 °C 17.9–26.7

Min temp (night)11.1 °C 7.50–14.2

Precipitation70.1 mm/mo 5.90–126

Air humidity53.5 % 45.5–63.1

Moisture balance-69.3 mm/mo -172–-2.90

Vapour deficit862 Pa 627–1,212

Wind speed2.10 m/s 1.20–3.00

Cloud cover37.4 % 12.9–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)