Anasterias antarctica

(Lütken, 1857) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Asteroidea/Forcipulatida/Asteriidae/Anasterias

At a glance

Occurrence records1 065

Data sources9

Biological traits4

DNA specimens28

eDNA detections0

Sources9 archives

Databases and archives Anasterias antarctica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility751 records↗

OBISOcean Biodiversity Information System314 records↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS · NPASS21 compounds

Occurrence & distributionGBIF · OBIS1 065 records

DNA & barcodingBOLD28 specimens

01Narrative

Anasterias antarctica, commonly called the Cinderella starfish, is a species of starfish in the family Asteriidae. It is found in coastal waters in the Southern Ocean and around Antarctica.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max190 m

Depth min0 m

03Chemical composition21 compounds

Compounds documented for Anasterias antarctica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cholestane steroids7

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
(22e,24r)-24-O-(beta-d-xylopyranosyl)-5alpha-cholest-22-ene-3beta,6alpha,8,15beta,24-pentol	present	NPASS
(3S,5S,6S,8S,9R,10S,13R,14S,15R,17R)-10,13-dimethyl-17-[(2R,5S)-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyheptan-2-yl]-1,2,3,4,5,6,7,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-3,6,8,15-tetrol	present	NPASS
2-[[(E,2S,3R,6R)-2,3-dimethyl-6-[(3S,5S,6S,8S,9R,10S,13R,14S,15R,17R)-6,8,15-trihydroxy-10,13-dimethyl-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-1,2,3,4,5,6,7,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-17-yl]hept-4-enoyl]amino]ethanesulfonic acid	present	LOTUS
[(3S,5R,6R,8R,10R,13R,14R,17R)-6-[(2S,3S,4R,5R,6R)-4-[(2S,3R,4S,5S)-5-[(2R,3S,4R,5R,6R)-3-[(2S,3S,4S,5R,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-hydroxy-3-[(2R,3R,4S,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-6-methyloxan-2-yl]oxy-17-[(2R)-2-hydroxy-6-methyl-4-oxoheptan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] hydrogen sulfate	present	LOTUS
[(3S,5S,6S,8S,10S,13R,14S,17R)-6-[(2R,3R,4S,5R,6R)-4-[(2S,3R,4S,5R)-5-[(2S,3R,4S,5R,6R)-3-[(2S,3R,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-17-[(2R)-6-methyl-4-oxoheptan-2-yl]-2,3,4,5,6,7,8,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] hydrogen sulfate	present	LOTUS
[(3S,5S,6S,8S,10S,13R,14S,17S)-17-acetyl-6-[(2R,3R,4S,5R,6R)-4-[(2S,3R,4S,5R)-5-[(2S,3S,4S,5R,6R)-3-[(2S,3R,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-2,3,4,5,6,7,8,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl] hydrogen sulfate	present	LOTUS
[(3S,5S,6S,8S,9R,10S,13R,14S,15R,17R)-6,8,15-trihydroxy-10,13-dimethyl-17-[(E,2R,5R)-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyhept-3-en-2-yl]-1,2,3,4,5,6,7,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-yl] hydrogen sulfate	present	LOTUS
BVPGZGLTZTXFGT-GTKUBWCQSA-M	present	NPASS
CTVYBBZGUXOEAT-VNGAATLESA-M	present	NPASS
CUAFSYZFCISZHW-LNRPABBPSA-M	present	NPASS

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anasterias antarctica has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

19Tmostly conserved

163Gmostly conserved

197Cmostly conserved

205Cvariable

217Amostly conserved

352Gvariable

361Amostly conserved

597Tmostly conserved

622Tmostly conserved

655Tmostly conserved

TACTCTTTATTTAATATTTGGAGCCTGAGCAGGAATGATTGGAACCGCTATGAGAGTAATAATACGAACTGAACTAGCCCAACCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes8

BIN1

Most divergent pair0.91%

S.AmericaAntarctica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anasterias directasame genus4.7%Anasterias perrierisame genus5.0%Anasterias suterisame genus6.4%Lysasterias perrierisame family10.5%Diplasterias bruceisame family12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 065 records

Wild obs. + sensor596

Museum / vouchered450

Other19

Range

Area of Occupancy AOO1 576 km²

Depth

0–200 m sunlit80

200–1000 m twilight13

1–4 km midnight0

>4 km abyssal0

median 47 m · max 769.5 m · 93 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 93≤1 km 85≤10 km 26>10 km 3

207 georeferenced · 389 without coordinates

Open the mapobservation + sensor596

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 109≤1 km 28≤10 km 53>10 km 12

202 georeferenced · 248 without coordinates

Open the institutions mapphysical evidence450

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	85
Museo Nacional de Historia Natural de Chilelocation not on record	72
Buenos Aires, AR	58
IBIOMARlocation not on record	25
Cambridge, US	22
fcnym.unlp.edu.arlocation not on record	16
Universite Libre de Bruxelleslocation not on record	14
UMAGlocation not on record	8
Museo de Zoología de la Universidad de Concepción (UCCC_MZUC)location not on record	5
CASlocation not on record	4
South Kensington, GB	4
Brussels, BE	3
CEQUAlocation not on record	3
RBINS-Scientific Heritagelocation not on record	2
Earth Sciences New Zealandlocation not on record	1
Paris, FR	1
Montgomery, US	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
Universidad Católica del Nortelocation not on record	1
University of Oslo (UiO)location not on record	1
Copenhagen, DK	1

21 institutions · 328 of 450 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anasterias antarctica

At a glance

Sources9 archives

Habitat & environment2

Other traits2

Compound class profile1 class

Documented compounds21 total

At a glance

Record type1 065 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Record type1 065 records