Anastatus japonicus

Ashmead, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Eupelmidae/Anastatus

At a glance

Occurrence records42

Data sources6

Biological traits0

DNA specimens52

eDNA detections51

Sources6 archives

Databases and archives Anastatus japonicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF42 records

Environmental DNA1 datasets · 2 countries51 detections

DNA & barcodingBOLD52 specimens

01Narrative

Anastatus japonicus is een vliesvleugelig insect uit de familie Eupelmidae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1904 door Ashmead.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastatus japonicus has left across the world's sequence archives.

At a glance

DNA specimens52

BINs1

Marker genes1

eDNA detections51

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

35Gvariable

43Tmostly conserved

55Gmostly conserved

88Tmostly conserved

103Cvariable

235Cmostly conserved

271Tmostly conserved

277Gmostly conserved

287Cmostly conserved

310Gmostly conserved

325Amostly conserved

343Cmostly conserved

370Gmostly conserved

373Cmostly conserved

415Gvariable

508Tmostly conserved

511Avariable

625Amostly conserved

628Cvariable

AATTTTGTATTTTATTTTTGGGATATGATCTGGGGTTGTTGGTTTATCTTTAAGGATATTAATTCGTATAGAATTGGGTTCATGTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes7

BIN1

Most divergent pair2.1%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anastatus fulloisame genus8.0%Anastatus gastropachaesame genus8.9%Anastatus echidnasame genus9.6%Anastatus gansuensissame genus10.0%Anastatus dexingensissame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor7

Museum / vouchered35

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 5 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	2
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Eszterhazy Karoly University of Applied Scienceslocation not on record	1

3 institutions · 4 of 35 vouchered records shown · 31 without an institution code

09Environmental DNA51 detections

Where the DNA of Anastatus japonicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 21.6–27.2

Seasonal swing summer↔winter31.0 °C

Max temp (day)31.0 °C 24.8–31.5

Min temp (night)22.0 °C 18.2–22.2

Precipitation189 mm/mo 115–189

Air humidity60.9 % 58.4–61.7

Moisture balance32.1 mm/mo 0.7–32.1

Vapour deficit1,385 Pa 859–1,511

Wind speed2.10 m/s 1.40–2.90

Cloud cover35.9 % 34.8–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)