Anasa tristis

(De Geer, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Coreidae/Anasa

At a glance

Occurrence records3 665

Data sources9

Biological traits0

DNA specimens26

eDNA detections23

Sources9 archives

Databases and archives Anasa tristis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 665 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 665 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD26 specimens

Genome at a glanceGoaT2n = 22

01Narrative

Eggs on underside of squash plant's leaf Squash bug eggs on the underside of yellow crookneck squash leaves Nymphs of several instars, on squash Anasa tristis is a species of bug in the family Coreidae. It is a major pest of squash and pumpkins, found throughout North America, and is a vector of the cucurbit yellow vine disease bacterium.Arnold, 2001 These bugs can emit an unpleasant odor when disturbed. It is commonly known as the squash bug but shares this name with certain other species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anasa tristis has left across the world's sequence archives.

At a glance

DNA specimens26

BINs1

Marker genes3

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P620 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

167Tmostly conserved

228Cmostly conserved

266Tmostly conserved

320Cmostly conserved

447Cmostly conserved

462Cmostly conserved

468Gmostly conserved

495Tmostly conserved

512Gmostly conserved

566Amostly conserved

615Cmostly conserved

TAGGATCATCTATAAGATGAATTATTCGAGTAGAACTTGGTCAACCAGGTTCATTTATTGGTGATGATCAAATCTATAATGTTATTGTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes5

BIN1

Most divergent pair1.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hypselonotus fulvussame family13.2%Althos obscuratorsame family13.5%Hypselonotus lineatussame family14.2%Dysdercus cingulatussame order14.5%Scantius aegyptiussame order14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Anasa tristis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 211×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 221×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type3 665 records

Wild obs. + sensor2 897

Museum / vouchered768

Range

Area of Occupancy AOO10 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 686≤1 km 270≤10 km 122>10 km 379

2 457 georeferenced · 440 without coordinates

Open the mapobservation + sensor2 897

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 5≤1 km 24≤10 km 317>10 km 45

391 georeferenced · 377 without coordinates

Open the institutions mapphysical evidence768

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	292
North Carolina State University Insect Museumlocation not on record	148
Vernal, US	85
Mississippi State, US	49
Albuquerque, US	26
US	25
New Haven, US	21
Natural History Museum of Utahlocation not on record	20
Universidad Católica de Manizaleslocation not on record	19
Vancouver, CA	15
Mexico City, MX	13
Sam Noble Oklahoma Museum of Natural Historylocation not on record	9
San Francisco, US	8
University of Guelphlocation not on record	6
Chicago, US	3
Montgomery, US	3
University Park, US	3
DPIlocation not on record	2
Cambridge, US	1
CUlocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
East Lansing, US	1
SOVTlocation not on record	1
Decorah, US	1

25 institutions · 754 of 768 vouchered records shown · 14 without an institution code

09Environmental DNA23 detections

Where the DNA of Anasa tristis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 13.8–24.9

Seasonal swing summer↔winter26.1 °C

Max temp (day)24.6 °C 18.8–30.2

Min temp (night)15.5 °C 8.20–20.4

Precipitation93.9 mm/mo 57.2–130

Air humidity59.5 % 48.2–60.3

Moisture balance-41.6 mm/mo -100–-25.7

Vapour deficit910 Pa 743–1,292

Wind speed3.00 m/s 2.60–3.60

Cloud cover40.0 % 25.3–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anasa tristis

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 665 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 665 records