Anasa scorbutica

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Coreidae/Anasa

At a glance

Occurrence records522

Data sources7

Biological traits0

DNA specimens5

eDNA detections1

Sources7 archives

Databases and archives Anasa scorbutica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility522 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF522 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD5 specimens

01Narrative

Anasa scorbutica is a species of leaf-footed bug in the family Coreidae. It is found in the Caribbean Sea, Central America, North America, South America, and the Caribbean.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anasa scorbutica has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.60%

Haplotypes1

BIN1

Where individuals differ — all 8 variable positions, in barcode order

115Cmostly conserved

196Gmostly conserved

295Tmostly conserved

511Tmostly conserved

530Tvariable

584Gmostly conserved

622Gvariable

634Cmostly conserved

CTTATATTTTATTTTTGGTATATGATCAGGAATAGTAGGTTCATCAATAAGATGAATTATCCGTGTAGAACTTGGTCAACCCGGCTCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anasa armigerasame genus2.8%Anasa bellatorsame genus11.8%Riptortus linearissame order13.6%Riptortus serripessame order13.8%Piezogaster indecorussame family13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type522 records

Wild obs. + sensor295

Museum / vouchered227

Range

Area of Occupancy AOO1 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 121≤1 km 43≤10 km 22>10 km 33

219 georeferenced · 76 without coordinates

Open the mapobservation + sensor295

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 84≤1 km 18≤10 km 5

107 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence227

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	101
National Biodiversity Institute, Costa Ricalocation not on record	63
Mexico City, MX	42
Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record	2
University of Central Floridalocation not on record	2
University of Abidjanlocation not on record	1
Ciudad de México, MX	1
San Francisco, US	1
Australian National Insect Collectionlocation not on record	1

9 institutions · 214 of 227 vouchered records shown · 13 without an institution code

09Environmental DNA1 detections

Where the DNA of Anasa scorbutica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)