Anarthria scabra

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Restionaceae/Anarthria

At a glance

Occurrence records859

Data sources9

Biological traits27

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Anarthria scabra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility859 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF859 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 44

01Narrative

Anarthria scabra is an herbaceous plant found in Southwest Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length5 mm

Fruit width6.25 mm

Leaf length150 mm

Leaf width8.5 mm

Plant height1 m

Plant height max1.5 m

Plant height min0.35 m

Life cycle & reproduction6

Flowering timennnnnnnyyyyy

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Anarthria scabra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3,3'-di-O-methylquercetin		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarthria scabra has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKF181925.1 ↗2 448 bp

ACGT

ATGAATGGAAAAAAGAGCATGTCGTAATAAAATCAAGAATCCGAAATTTTATGAATTTCTTTTAAATTAAACTCGGAGTTTACCCTTACC …

Anarthria scabra voucher NSW784520 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Anarthria scabra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 442×CCDB · book-ipcn66 · CCDB · book-fedorov

CCDB · book-ipcn66 — Briggs1966

CCDB · book-fedorov — Briggs 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type859 records

Wild obs. + sensor428

Museum / vouchered430

Cultivated / captive1

Origin

Native73

Range

Area of Occupancy AOO1 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 225≤1 km 90≤10 km 20>10 km 9

344 georeferenced · 84 without coordinates

Open the mapobservation + sensor428

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 65≤1 km 27≤10 km 183>10 km 26

301 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence430

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	191
Mount Annan, AU	72
Museo Entomologico de Leonlocation not on record	52
Canberra, AU	36
Adelaide, AU	29
Brisbane, AU	12
Kew, GB	7
BGPAlocation not on record	6
Moscow State Universitylocation not on record	4
MAlocation not on record	4
John T. Waterhouse Herbariumlocation not on record	2
Claremont, US	2
Auckland, NZ	2
Saint Louis, US	2
Hobart, AU	1
Zürich, CH	1
Boise, US	1
Palmerston, AU	1
Armidale, AU	1
LDlocation not on record	1

20 institutions · 427 of 430 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)