Anarta sodae

Boisduval, 1829 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anarta

At a glance

Occurrence records1 602

Data sources6

Biological traits0

DNA specimens7

eDNA detections7

Sources6 archives

Databases and archives Anarta sodae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 602 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 602 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anarta sodae is een vlinder uit de familie uilen (Noctuidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1829 door Rambur. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarta sodae has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

59Cmostly conserved

118Tmostly conserved

127Gmostly conserved

166Amostly conserved

235Cvariable

238Cmostly conserved

337Amostly conserved

340Tmostly conserved

415Tmostly conserved

544Amostly conserved

580Cmostly conserved

653Cmostly conserved

AACATTATATTTTATCTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCCGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes3

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarta stigmosasame genus3.4%Anarta sabulorumsame genus3.7%Scotogramma fieldisame family4.3%Scotogramma yakimasame family4.4%Lacanobia oleraceasame family4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 602 records

Wild obs. + sensor969

Museum / vouchered37

Other596

Origin

Native19

Range

Area of Occupancy AOO1 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 309≤1 km 130≤10 km 51>10 km 69

559 georeferenced · 410 without coordinates

Open the mapobservation + sensor969

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nijmegen, NL	15
UMUlocation not on record	11
Helsinki, FI	5
Tartu, EE	2
Philadelphia, US	1

5 institutions · 34 of 37 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Anarta sodae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 17.2–21.4

Seasonal swing summer↔winter15.1 °C

Max temp (day)21.2 °C 19.9–26.7

Min temp (night)15.0 °C 14.2–17.0

Precipitation32.6 mm/mo 17.2–44.2

Air humidity59.1 % 54.0–66.0

Moisture balance-100 mm/mo -151–-72.8

Vapour deficit885 Pa 741–1,176

Wind speed4.50 m/s 2.10–5.00

Cloud cover37.2 % 30.3–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anarta sodae

At a glance

Sources6 archives

At a glance

Record type1 602 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 602 records