Anarta mutata

Dod, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anarta

At a glance

Occurrence records230

Data sources5

Biological traits0

DNA specimens23

eDNA detections22

Sources5 archives

Databases and archives Anarta mutata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility230 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF230 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD23 specimens

01Narrative

Anarta mutata, or the mutant, is a species of cutworm or dart moth in the family Noctuidae. The MONA or Hodges number for Anarta mutata is 10224.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarta mutata has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

212Cmostly conserved

271Cmostly conserved

565Amostly conserved

AACATTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes8

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Scotogramma yakimasame family3.3%Scotogramma fervidasame family3.6%Anarta chartariasame genus3.8%Scotogramma gateisame family4.0%Anarta fulgorasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type230 records

Wild obs. + sensor78

Museum / vouchered152

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 45≤1 km 6≤10 km 11>10 km 7

69 georeferenced · 9 without coordinates

Open the mapobservation + sensor78

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 25≤1 km 2≤10 km 8>10 km 3

38 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence152

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	67
East Lansing, US	18
Colorado State Universitylocation not on record	17
US	11
ASUlocation not on record	8
St. Paul, US	6
Royal Saskatchewan Museumlocation not on record	6
Oregon State Arthropod Collectionlocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Albuquerque, US	1
New Haven, US	1
WWUlocation not on record	1

12 institutions · 144 of 152 vouchered records shown · 8 without an institution code

09Environmental DNA22 detections

Where the DNA of Anarta mutata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

Grassland8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 17.6–27.0

Seasonal swing summer↔winter18.8 °C

Max temp (day)28.4 °C 23.8–32.7

Min temp (night)15.5 °C 10.7–21.7

Precipitation49.1 mm/mo 9.30–112

Air humidity50.1 % 38.7–54.2

Moisture balance-105 mm/mo -175–-55.3

Vapour deficit1,347 Pa 974–1,797

Wind speed2.20 m/s 1.30–3.80

Cloud cover21.5 % 14.8–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)