Anarta decepta

Grote, 1883 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anarta

At a glance

Occurrence records156

Data sources6

Biological traits0

DNA specimens22

eDNA detections29

Sources6 archives

Databases and archives Anarta decepta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility156 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF156 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD22 specimens

01Narrative

Anarta decepta is a moth of the family Noctuidae. It was described by Augustus Radcliffe Grote in 1883 from Colorado and is found along the Pacific Coast of the United States and Canada. It was first discovered in Hawaii in light trap catches made in the Pearl Harbor area on Oahu in the autumn of 1947. The wingspan is 28–29 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarta decepta has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

76Avariable

100Tvariable

205Ahighly variable

238Tvariable

283Tmostly conserved

304Tvariable

547Cmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes9

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarta anticasame genus3.3%Scotogramma fieldisame family4.0%Scotogramma gateisame family4.3%Tridepia novasame family4.6%Scotogramma yakimasame family4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type156 records

Wild obs. + sensor18

Museum / vouchered138

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 2≤1 km 3≤10 km 6>10 km 6

17 georeferenced · 1 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 33≤1 km 5≤10 km 21>10 km 10

69 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	47
East Lansing, US	17
San Diego, US	17
Oregon State Arthropod Collectionlocation not on record	15
Vernal, US	12
University of Alberta Museums (UAM)location not on record	9
Awka, NG	4
Albuquerque, US	3
New Haven, US	3
ASUlocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
King Saud Universitylocation not on record	1

12 institutions · 130 of 138 vouchered records shown · 8 without an institution code

09Environmental DNA29 detections

Where the DNA of Anarta decepta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

interdune vegetationdunes, UVinterdunal vegetation, gypsum

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 12.5–27.0

Seasonal swing summer↔winter21.4 °C

Max temp (day)26.6 °C 16.4–33.1

Min temp (night)13.1 °C 5.20–19.8

Precipitation18.1 mm/mo 5.50–46.1

Air humidity46.5 % 38.8–52.3

Moisture balance-100 mm/mo -180–-59.9

Vapour deficit1,298 Pa 631–1,938

Wind speed2.70 m/s 1.50–3.70

Cloud cover27.1 % 18.4–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)