Anarsia dryinopa

Lower, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anarsia

At a glance

Occurrence records51

Data sources8

Biological traits0

DNA specimens134

eDNA detections134

Sources8 archives

Databases and archives Anarsia dryinopa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI134 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics134 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF51 records

Environmental DNA1 datasets · 2 countries134 detections

DNA & barcodingBOLD134 specimens

01Narrative

Anarsia dryinopa is a moth of the family Gelechiidae. It is known from Australia and the warmer regions of New Zealand in both the North and the South Islands.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding134 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarsia dryinopa has left across the world's sequence archives.

At a glance

DNA specimens134

BINs2

Marker genes1

eDNA detections134

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus122 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

1Amostly conserved

43Cmostly conserved

56Cmostly conserved

58Tmostly conserved

79Cmostly conserved

82Amostly conserved

124Tmostly conserved

130Cmostly conserved

175Tmostly conserved

178Tmostly conserved

199Cmostly conserved

202Amostly conserved

203Tmostly conserved

205Amostly conserved

209Cmostly conserved

217Amostly conserved

253Amostly conserved

260Tmostly conserved

268Cmostly conserved

275Cmostly conserved

277Tmostly conserved

280Tmostly conserved

289Tmostly conserved

295Amostly conserved

301Cmostly conserved

319Tmostly conserved

334Amostly conserved

337Tvariable

346Tvariable

367Amostly conserved

379Amostly conserved

397Amostly conserved

398Tmostly conserved

400Amostly conserved

403Tmostly conserved

412Amostly conserved

418Tmostly conserved

433Amostly conserved

454Tmostly conserved

472Cmostly conserved

475Cmostly conserved

476Cmostly conserved

503Amostly conserved

514Amostly conserved

526Amostly conserved

530Cmostly conserved

532Tmostly conserved

539Tmostly conserved

541Amostly conserved

544Tmostly conserved

550Tmostly conserved

554Cmostly conserved

562Gmostly conserved

586Cmostly conserved

592Cvariable

604Tmostly conserved

607Cmostly conserved

613Tmostly conserved

625Amostly conserved

628Tvariable

631Cvariable

ATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTACTTATTCGAGCTGAATTAGGTAACCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes6

BINs2

Most divergent pair9.6%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarsia sibiricasame genus7.9%Anarsia bilbainellasame genus8.0%Miaromima columbinasame order8.6%Tyana falcatasame order9.0%Asura cervicalissame order9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor38

Museum / vouchered13

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 19≤1 km 6≤10 km 1

26 georeferenced · 12 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1>10 km 2

3 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	2
New Zealand Arthropod Collectionlocation not on record	1
Auckland, NZ	1
Australian National Insect Collectionlocation not on record	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

5 institutions · 6 of 13 vouchered records shown · 7 without an institution code

09Environmental DNA134 detections

Where the DNA of Anarsia dryinopa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found134

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 134 detections have coordinates

Open the map2 countries0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 19.6–23.5

Seasonal swing summer↔winter11.5 °C

Max temp (day)28.7 °C 24.6–29.7

Min temp (night)17.1 °C 14.5–19.0

Precipitation22.0 mm/mo 15.7–54.9

Air humidity50.9 % 49.9–56.1

Moisture balance-121 mm/mo -139–-48.0

Vapour deficit1,362 Pa 1,047–1,454

Wind speed3.10 m/s 2.70–4.50

Cloud cover16.8 % 16.3–27.4

CHELSA 1981–2010, ~9 km grid, at location & month of 134 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)