Anarpia incertalis

Duponchel, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anarpia

At a glance

Occurrence records145

Data sources6

Biological traits0

DNA specimens20

eDNA detections10

Sources6 archives

Databases and archives Anarpia incertalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF145 records

Environmental DNA1 datasets · 4 countries10 detections

DNA & barcodingBOLD20 specimens

01Narrative

Anarpia incertalis is a species of moth in the family Crambidae. It is found in France, Spain, Portugal, Italy, Croatia, Bosnia and Herzegovina, Bulgaria, the Republic of Macedonia, Greece and on Corsica, Sardinia, Sicily, Crete and Cyprus,Fauna Europaea as well as in Iraq, Russia and North Africa, including Morocco.BOLD Systems

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarpia incertalis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes2

eDNA detections10

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

22Amostly conserved

59Tvariable

88Amostly conserved

100Avariable

118Tvariable

139Tvariable

193Tmostly conserved

208Avariable

220Cvariable

235Cvariable

247Tvariable

304Cvariable

307Gvariable

313Tvariable

337Tmostly conserved

382Avariable

394Cvariable

400Tvariable

401Tvariable

427Cvariable

428Cvariable

451Tmostly conserved

457Cvariable

463Tvariable

506Gvariable

514Tvariable

529Cvariable

533Cmostly conserved

542Cvariable

562Amostly conserved

581Cvariable

589Tvariable

607Tvariable

622Tvariable

640Tvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAACAGTAGGAACATCATTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes7

BINs2

Most divergent pair5.0%

AsiaEuropeAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarpia iranellasame genus2.1%Scoparia exhibitalissame family5.6%Eudonia sudeticasame family6.1%Eudonia mercurellasame family6.5%Scoparia anthraciassame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type145 records

Wild obs. + sensor125

Museum / vouchered20

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 41≤1 km 29≤10 km 2>10 km 7

79 georeferenced · 46 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤1 km 5≤10 km 7>10 km 7

19 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	19

1 institutions · 19 of 20 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Anarpia incertalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 15.1–24.7

Seasonal swing summer↔winter16.5 °C

Max temp (day)27.0 °C 18.8–31.0

Min temp (night)14.5 °C 11.1–19.0

Precipitation25.0 mm/mo 7.50–65.6

Air humidity50.0 % 44.4–57.6

Moisture balance-131 mm/mo -186–-48.4

Vapour deficit1,193 Pa 835–1,660

Wind speed2.90 m/s 2.00–5.60

Cloud cover23.6 % 7.90–34.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)