Anarmodia nebulosalis

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anarmodia

At a glance

Occurrence records303

Data sources6

Biological traits0

DNA specimens173

eDNA detections175

Sources6 archives

Databases and archives Anarmodia nebulosalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility303 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI175 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics173 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF303 records

Environmental DNA1 datasets · 1 countries175 detections

DNA & barcodingBOLD173 specimens

01Narrative

Anarmodia nebulosalis is a moth in the family Crambidae. It was described by Paul Dognin in 1903. It is found in Ecuador.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding173 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarmodia nebulosalis has left across the world's sequence archives.

At a glance

DNA specimens173

BINs1

Marker genes1

eDNA detections175

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus168 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

562Tmostly conserved

TACTTTATATTTTATTTTTGGTATTTGAGCTGGATTATTAGGAACATCTTTAAGTTTGTTAATCCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.06%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarmodia inflexalissame genus6.5%Anarmodia repandalissame genus7.0%Sparagmia gonopterasame family8.1%Pygospila tyressame family8.1%Bradina diagonalissame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type303 records

Wild obs. + sensor15

Museum / vouchered288

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 5≤1 km 4≤10 km 3

12 georeferenced · 3 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 288 records without

Open the institutions mapphysical evidence288

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	238
University of Pennsylvanialocation not on record	3
Mississippi State, US	1

3 institutions · 242 of 288 vouchered records shown · 46 without an institution code

09Environmental DNA175 detections

Where the DNA of Anarmodia nebulosalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found175

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 175 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.1–25.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.8–28.4

Min temp (night)21.2 °C 20.7–22.6

Precipitation244 mm/mo 20.6–468

Air humidity69.8 % 61.4–75.5

Moisture balance118 mm/mo -133–334

Vapour deficit914 Pa 717–1,171

Wind speed2.30 m/s 1.20–5.60

Cloud cover30.5 % 13.6–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 174 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)