Anarchopterus criniger

(Bean & Dresel, 1884) · species

image placeholder — illustration coming later

Animalia/Chordata/Syngnathiformes/Syngnathidae/Anarchopterus

At a glance

Occurrence records2 170

Data sources10

Biological traits4

DNA specimens17

eDNA detections18

Sources10 archives

Databases and archives Anarchopterus criniger's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 070 records↗

OBISOcean Biodiversity Information System1 100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS2 170 records

Environmental DNA1 datasets · 3 countries18 detections

DNA & barcodingBOLD17 specimens

01Narrative

Anarchopterus criniger, also known as the fringed pipefish, is a species of marine fish of the family Syngnathidae. It is found in the western Atlantic Ocean from North Carolina to Florida and the northern Bahamas, in the Gulf of Mexico from Louisiana to the Florida Keys, and along the Yucatán Peninsula in Mexico. It also occurs along the whole coast of Brazil. It lives in shallow waters over seagrass beds, mud banks, and floating algae, and can grow to a length of 10 cm. This species is ovoviviparous, with the male carrying eggs in a brood pouch until they are ready to hatch.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarchopterus criniger has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections18

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

106Avariable

112Cmostly conserved

160Avariable

202Amostly conserved

226Avariable

241Avariable

298Amostly conserved

301Tmostly conserved

310Amostly conserved

319Gvariable

340Cmostly conserved

364Cvariable

394Cmostly conserved

413Gmostly conserved

415Tvariable

445Tmostly conserved

514Avariable

526Cmostly conserved

530Tmostly conserved

568Cmostly conserved

646Amostly conserved

CCTATATTTAGTATTTGGTGCATGAGCTGGAATAGTCGGTACCGCACTTAGTCTGCTAATTCGAGCAGAACTCAGCCAACCGGGCGCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes9

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sorubim cuspicaudussame order17.2%Cosmocampus brachycephalussame family17.5%Inimicus sinensissame order17.5%Monopterus indicussame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 170 records

Wild obs. + sensor1 866

Museum / vouchered304

Origin

Native17

Range

Area of Occupancy AOO1 252 km²

Depth

0–200 m sunlit891

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.6 m · max 11 m · 891 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1 772≤1 km 5>10 km 2

1 779 georeferenced · 87 without coordinates

Open the mapobservation + sensor1 866

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 14≤1 km 16≤10 km 33>10 km 1

64 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence304

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	60
Washington, US	18
Texas Cooperative Wildlife Collectionlocation not on record	15
Centro de Investigación y de Estudios Avanzados, Unidad Irapuato, Instituto Politécnico Nacionallocation not on record	6
University of Texas Biodiversity Collections (UTBC)location not on record	6
Ann Arbor, US	6
UNICAMPlocation not on record	4
North Carolina Museum of Natural Scienceslocation not on record	3
Southeastern Louisiana University, Vertebrate Museumlocation not on record	2
University of Alabamalocation not on record	2
New Haven, US	1
Cambridge, US	1
Tapachula, MX	1
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	1
Florida State University Coastal and Marine Laboratorylocation not on record	1

15 institutions · 127 of 304 vouchered records shown · 6 without an institution code

09Environmental DNA18 detections

Where the DNA of Anarchopterus criniger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 24.2–27.6

Seasonal swing summer↔winter7.30 °C

Max temp (day)28.4 °C 25.0–29.6

Min temp (night)26.0 °C 22.6–26.2

Precipitation124 mm/mo 58.8–216

Air humidity62.2 % 59.0–64.6

Moisture balance18.9 mm/mo

Vapour deficit1,275 Pa 1,178–1,348

Wind speed4.70 m/s

Cloud cover32.2 % 28.1–35.2

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anarchopterus criniger

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Other traits1

At a glance

Record type2 170 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 170 records