Anaplectoides pressus

Grote, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anaplectoides

At a glance

Occurrence records1 005

Data sources7

Biological traits0

DNA specimens133

eDNA detections136

Sources7 archives

Databases and archives Anaplectoides pressus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 005 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI136 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics133 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 005 records

Environmental DNA1 datasets · 2 countries136 detections

DNA & barcodingBOLD133 specimens

01Narrative

Anaplectoides pressus, the dappled dart moth, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Anaplectoides pressus is 11001.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding133 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaplectoides pressus has left across the world's sequence archives.

At a glance

DNA specimens133

BINs1

Marker genes1

eDNA detections136

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus132 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

50Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTGGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGGAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes11

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaplectoides prasinasame genus3.3%Spaelotis unicavasame family4.3%Spaelotis quadricavasame family4.3%Spaelotis bicavasame family4.4%Parabagrotis insularissame family4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 005 records

Wild obs. + sensor378

Museum / vouchered627

Range

Area of Occupancy AOO1 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 275≤1 km 18≤10 km 13>10 km 10

316 georeferenced · 62 without coordinates

Open the mapobservation + sensor378

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 55≤1 km 68≤10 km 86>10 km 5

214 georeferenced · 413 without coordinates

Open the institutions mapphysical evidence627

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	143
East Lansing, US	77
University of Guelph, Centre for Biodiversity Genomicslocation not on record	55
New Haven, US	51
Colorado State Universitylocation not on record	45
Royal Saskatchewan Museumlocation not on record	26
Oregon State Arthropod Collectionlocation not on record	21
Helsinki, FI	17
Vernal, US	12
Brussels, BE	9
St. Paul, US	8
Edmonton, CA	8
UNHClocation not on record	7
WWUlocation not on record	5
RBINS-Scientific Heritagelocation not on record	5
Denver, US	4
Cambridge, US	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Mississippi State, US	1
Philadelphia, US	1
KWPlocation not on record	1
Saint John, CA	1

22 institutions · 502 of 627 vouchered records shown · 125 without an institution code

09Environmental DNA136 detections

Where the DNA of Anaplectoides pressus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found136

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 136 detections have coordinates

Open the map2 countries0

Riparian Zonemixed forest1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestForestBeach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 9.40–18.5

Seasonal swing summer↔winter24.6 °C

Max temp (day)20.9 °C 15.6–25.5

Min temp (night)11.0 °C 3.80–14.8

Precipitation66.5 mm/mo 43.8–119

Air humidity55.9 % 50.9–63.5

Moisture balance-46.8 mm/mo -79.7–13.8

Vapour deficit786 Pa 536–1,038

Wind speed1.90 m/s 1.10–4.80

Cloud cover39.7 % 34.9–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 132 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaplectoides pressus

At a glance

Sources7 archives

At a glance

Record type1 005 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 005 records