Anaphalis margaritacea
(L.) Benth. · speciesAt a glance
Occurrence records45 060
Data sources13
Biological traits125
DNA specimens73
eDNA detections47
Sources13 archives
Databases and archives Anaphalis margaritacea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility45 060 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics73 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources125 traits
Chemical compositionLOTUS · NPASS95 compounds
Occurrence & distributionGBIF45 060 records
Environmental DNA1 datasets · 4 countries47 detections
DNA & barcodingBOLD · NCBI73 specimens
Genome at a glanceCCDB2n = 28
01Narrative
L'Immortelle d'argent ou Immortelle blanche est une espèce de plantes à fleurs de la famille des Astéracées que l'on trouve en Asie et en Amérique du Nord. Elle fut plantée en tant que plante ornementale et s'est ainsi naturalisée dans le nord et le centre de l'Europe.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVPUSDA
Size & morphology19
Fruit length0.7 mm
Fruit length max0.7 mm
Fruit length min0.7 mm
Leaf length65 mm
Leaf length max100 mm
Leaf length min30 mm
Leaf mass1 043 mg
Leaf size345 mm²
⚠ sources differ — TRY: 345 mm² · LEDA: 1 471 mm² · GIFT: 1 471 mm²
Leaf width max12 mm
Leaf width min3 mm
Plant height0.91 m
⚠ sources differ — GIFT: 0.91 m · USDA: 0.914 m · TRY: 0.197 m
Plant height max0.8 m
Plant height min0.3 m
Seed mass0.081 mg
⚠ sources differ — TRY: 0.081 mg · LEDA: 0.02 mg · GIFT: 0.056 mg
Seed mass max0.19 mg
Seed mass min0.038 mg
Seed volume0.074 mm³
Seed volume max0.074 mm³
Seed volume min0.074 mm³
Life cycle & reproduction28
Bloom periodEarly Summer
Coppice potentialNo
Dispersal typehuman
Flower colouryellow
Flower conspicuousYes
Flowering endAug
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formperennial
Life spanperennial
Lifespan categoryShort
Lifespan years5 years
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateRapid
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment30
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 900 m
Elevation mean1 650 m
Elevation min500 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourblack
Fruit fleshinessdry
Growth formherb
Growth form USDARhizomatous
Habitat GIFTforest
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min6 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min120 days
Leaf C:N ratio100 g/g
Leaf c436 mg/g
Leaf dry-matter content (LDMC)294 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max35 in
Precipitation min10 in
Protein potentialMedium
Salinity toleranceNone
Seed longevity index0.25
Shade toleranceMedium
Soil pH max7.5 pH
Soil pH min6 pH
Specific leaf area (SLA)22.02 mm²/mg
⚠ sources differ — TRY: 22.02 mm²/mg · LEDA: 12.8 mm²/mg · GIFT: 12.8 mm²/mg
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound8 200 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typefruit
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max3 450 per acre
Planting density min2 700 per acre
03Chemical composition95 compounds
Compounds documented for Anaphalis margaritacea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols11
Ursane and Taraxastane triterpenoids7
Steroidal alkaloids7
Cinnamic acids and derivatives5
Spirostane steroids4
Documented compounds95 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | LOTUS | |
| (1R,2R,4R,5'R,6R,7S,8R,9S,12S,13S,16S,18S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-ol | present | NPASS | |
| (1R,2R,4R,5R,8S,11R,13S,14S,15R,16S,19S,22S,23R,25S)-2,19-dihydroxy-13,16,23-trimethyl-6,10,17,26,27,30-hexaoxanonacyclo[23.2.2.15,14.15,15.01,23.04,22.08,13.011,16.015,19]hentriacont-28-ene-9,18,24,31-tetrone | present | NPASS | |
| (1R,2S,4S,5'R,6R,7S,8R,9S,10R,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-10,16-diol | present | NPASS | |
| (1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(2R)-4-[(1R,2S,4S,6R,7S,8R,9S,12S,13S,16S,18S)-16-[(2R,3R,4R,5R,6R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-methoxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1R,2S,4S,5'R,6R,7S,8R,9S,10R,12S,13R,16S)-10-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (3R,4R)-3,4-Dihydroxy-3-methyloxolan-2-one | present | LOTUS | |
| (3R,6E)-3-chloro-6-octa-2,4,6-triynylidene-2,3-dihydropyran | present | LOTUS | |
| (3S,4aR,6aR,6aR,6bR,8aR,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-ol | present | LOTUS |
05DNA & barcoding73 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaphalis margaritacea has left across the world's sequence archives.
At a glance
DNA specimens73
Marker genes9
GenBank sequences10
eDNA detections47
Countries4
The DNA barcodea real sequence read deposited for this species
GCAAAGCAGAACGACCAGTGAACATGTAACTACAACTAGGCAAATTAGGGATTGAGCTTCTGTTTGATCCTTAACTGCCTTGTCGATGTG …
Anaphalis margaritacea voucher ABANERJEE64438A internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL3★rbcLa★ITS7★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Anaphalis margaritacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records26–422n range28median28mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2819×CCDB · brit-fl · CCDB · nw-europe-fl · CCDB · fl-europaea +8
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3979
CCDB · fl-europaea — Maude, 1940
CCDB · book-ipcn65 — Sokolovskaya 1965
CCDB · book-ipcn65 — Arano 1965
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Nishikawa, T. 1979. Chromosome counts of flowering plants of Hokkaido (2). Rep. Taisetsuzan Inst. Sci. 14: 15–23.
CCDB · ipcn-api-dl — Nishikawa, T. 1988. Chromosome counts of flowering plants of Hokkaido (11). J. Hokkaido Univ. Educ., Sect. 2B 38: 33–40.
CCDB · book-ipcn72 — KAPOOR, B.M. 1972. In IOPB chromosome number reports XXXV. Taxon 21: 161-166.
CCDB · book-ipcn67-71 — CHATTERJEE, T., & A.K. SHARMA. 1968. Cytological studies on different genera of three tribes of Compositae. Bull. Bot. Soc. Bengal 22: 101-104.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.
CCDB · book-indian_vol1 — Keil, D.J. & Pinkava, D.J. 1976
CCDB · book-indian_vol1 — Mehra, P.N. et al. 1965 ; Subramanyam, K. & Kamble, N.P. 1967 ; Chatterjee, T. & Sharma, A.K. 1968 ; Sarkar, A.K., Chakraverty, M. et a!. 1977
CCDB · book-fedorov — Mehra P. N. et al. 1965
CCDB · book-atlas-flowering-plants — Maude 1939
CCDB · Cave1963 — Arano 1963c
2n 273×CCDB · Cave1956
CCDB · Cave1956 — Arano
2n 262×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Salter, S. & D. J. PINKAVA. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 273–274.
2n 211×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — 28
2n 421×CCDB · eflora
CCDB · eflora
n 148×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +3
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Salter, S. & D. J. PINKAVA. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 273–274.
CCDB · book-ipcn66 — Taylor & Broclanan 1966
CCDB · book-ipcn67-71 — SUBRAMANYAM, K., & N. P. KAMBLE. 1967. In IOPB chromosome number reports XII. Taxon 16: 341-350.
CCDB · book-ipcn75-78 — Sarkar et al. 1977b
CCDB · book-ipcn75-78 — 28
CCDB · book-ipcn75-78 — Keil & Pinkava 1976
n 211×CCDB · book-ipcn65
CCDB · book-ipcn65 — Raj 1965
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type45 060 records
Wild obs. + sensor37 211
Museum / vouchered7 758
Cultivated / captive78
Other13
Origin
Native21
Introduced506
Range
Area of Occupancy AOO99 748 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 21 995≤1 km 3 467≤10 km 3 334>10 km 1 220
30 016 georeferenced · 7 195 without coordinates
Open the mapobservation + sensor37 211
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 383≤1 km 987≤10 km 1 659>10 km 222
3 251 georeferenced · 4 507 without coordinates
Open the institutions mapphysical evidence7 758
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 78 records without
Open the mapnot free-living78
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions170 of 291 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Chongqing Museumlocation not on record | 336 |
| Beijing, CN | 311 |
| Madison, US | 274 |
| Philadelphia, US | 252 |
| WTUlocation not on record | 250 |
| Bronx, US | 228 |
| Chengdu, CN | 226 |
| Québec, CA | 213 |
| Corvallis, US | 203 |
| Moscow, US | 199 |
| Pullman, US | 198 |
| St. Paul, US | 174 |
| Université Lavallocation not on record | 140 |
| Vancouver, CA | 138 |
| Acadia Universitylocation not on record | 109 |
| Guangzhou, CN | 106 |
| Missoula, US | 105 |
| Wuhan, CN | 104 |
| Kunming, CN | 100 |
| Boise, US | 99 |
| Yangling, CN | 94 |
| Chengdu, CN | 92 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 87 |
| Wuzhou, CN | 83 |
| Bando, JP | 78 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 78 |
| Saint John, CA | 78 |
| Burlington, US | 72 |
| University of New Hampshirelocation not on record | 71 |
| Arcata, US | 70 |
| Moscow State Universitylocation not on record | 66 |
| Ann Arbor, US | 65 |
| Seoul, KR | 62 |
| New Haven, US | 60 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 57 |
| University of Alberta Museumslocation not on record | 56 |
| Riverside, US | 53 |
| Spearfish, US | 53 |
| Claremont, US | 51 |
| Denver, US | 51 |
| Olocation not on record | 51 |
| CASlocation not on record | 51 |
| SLU Artdatabankenlocation not on record | 50 |
| LDlocation not on record | 48 |
| Nagatoro-machi, Chichibu-gun, JP | 47 |
| Central China Normal Universitylocation not on record | 47 |
| Davis, US | 46 |
| Victoria, CA | 46 |
| Green Bay, US | 45 |
| Bloomington, US | 44 |
| Flagstaff, US | 41 |
| Bozeman, US | 41 |
| Montréal, CA | 40 |
| WINlocation not on record | 40 |
| Provo, US | 37 |
| Saint Louis, US | 36 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 34 |
| Logan, US | 34 |
| Santa Barbara, US | 33 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 31 |
| University of Stellenboschlocation not on record | 31 |
| Oskarshamn, SE | 31 |
| University of Wisconsinlocation not on record | 30 |
| Pocatello, US | 29 |
| KMNlocation not on record | 29 |
| BFLlocation not on record | 27 |
| Albuquerque, US | 27 |
| San Luis Obispo, US | 25 |
| South Kensington, GB | 25 |
| Guilin, CN | 24 |
| Toronto, CA | 24 |
| KOMlocation not on record | 23 |
| Xining, CN | 23 |
| Canadian Department of Agriculturelocation not on record | 22 |
| DOI/NPS, Greenbelt Parklocation not on record | 22 |
| Bangkok, TH | 22 |
| Chiba, JP | 21 |
| Sanda, JP | 20 |
| Taipei, TW | 20 |
| Stockholm, SE | 19 |
| Chadron, US | 19 |
| San Diego, US | 19 |
| Taipei, TW | 19 |
| Nanjing, CN | 17 |
| DBF-NHMDlocation not on record | 17 |
| ASUlocation not on record | 16 |
| Cheney, US | 16 |
| Staten Island, US | 15 |
| Trondheim, NO | 15 |
| Fredericton Stock Culture Collectionlocation not on record | 15 |
| Taipei, TW | 15 |
| Durango, US | 14 |
| MeiseBGlocation not on record | 14 |
| Ashland, US | 13 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 12 |
| Santa Cruz, US | 12 |
| Philadelphia, US | 12 |
| San Francisco, US | 12 |
| Akita Prefectural Museumlocation not on record | 12 |
| Lanzhou, CN | 11 |
| Tartu, EE | 11 |
| Kew, GB | 11 |
| Paris, FR | 11 |
| University of Lethbridgelocation not on record | 11 |
| TAIElocation not on record | 11 |
| Cambridge, US | 11 |
| Portland, US | 11 |
| Guiyang, CN | 11 |
| USFS/BHSClocation not on record | 11 |
| Phoenix, US | 11 |
| Changsha, CN | 11 |
| Caldwell, US | 10 |
| Provincia di Livornolocation not on record | 10 |
| Anchorage, US | 8 |
| FJFClocation not on record | 8 |
| Hudson, US | 8 |
| Dekalb, US | 8 |
| Pittsburg, US | 8 |
| Rocky Mountain Biological Laboratorylocation not on record | 8 |
| Mohonk Preservelocation not on record | 8 |
| Los Angeles, US | 8 |
| Chongqing Natural History Museumlocation not on record | 8 |
| Durham, US | 8 |
| Millersville, US | 7 |
| San Angelo, US | 7 |
| Emporia, US | 7 |
| Bergen, NO | 7 |
| Orem, US | 7 |
| Bern, CH | 7 |
| Edinburgh, GB | 7 |
| Mississippi State, US | 6 |
| New Brunswick, US | 6 |
| Turlock, US | 6 |
| Tianjin Natural History Museumlocation not on record | 6 |
| Tempe, US | 6 |
| Tacoma, US | 6 |
| Kathmandu, NP | 6 |
| Fort Worth, US | 6 |
| Görlitz, DE | 5 |
| Kingston, US | 5 |
| Zhuzhou, CN | 5 |
| Baltimore, US | 5 |
| Bend, US | 5 |
| Mlocation not on record | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Turku, FI | 5 |
| Ypsilanti, US | 5 |
| IDElocation not on record | 5 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 5 |
| US | 5 |
| EL PASO, US | 5 |
| Oulu, FI | 5 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 5 |
| Memorial University of Newfoundlandlocation not on record | 4 |
| Keene State Universitylocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Chapel Hill, US | 4 |
| Wuhan, CN | 4 |
| 湖北神农架林区标本馆location not on record | 4 |
| Nanjing, CN | 4 |
| Strecker Museum, Baylor Universitylocation not on record | 4 |
| BRNUlocation not on record | 4 |
| Fargo, US | 4 |
| College Park, US | 4 |
| Xiamen, CN | 4 |
| Berlin, DE | 3 |
| TROMlocation not on record | 3 |
| HJAEFlocation not on record | 3 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 3 |
| Uppsala, SE | 3 |
| University of British Columbialocation not on record | 3 |
| Mount Pleasant, US | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| LfUlocation not on record | 3 |
| Trois-Rivières, CA | 3 |
| Xinxiang, CN | 3 |
| Wellington, NZ | 3 |
| H-Schuhwlocation not on record | 3 |
| PRClocation not on record | 3 |
| Zhengzhou, CN | 3 |
| Henderson, US | 3 |
| Northridge, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| KURAlocation not on record | 3 |
| McWane Science Centerlocation not on record | 3 |
| Whitehorse, CA | 3 |
| US | 3 |
| KNFHClocation not on record | 3 |
| Weber State Universitylocation not on record | 3 |
| Students On Ice Foundationlocation not on record | 3 |
| Whitewater, US | 3 |
| Cambridge, US | 3 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 3 |
| GJOlocation not on record | 3 |
| UFPRlocation not on record | 2 |
| Hamilton, US | 2 |
| STNFlocation not on record | 2 |
| Portland, US | 2 |
| Chicago, US | 2 |
| Fort Bragg, US | 2 |
| Truckee, US | 2 |
| BClocation not on record | 2 |
| University of Wisconsinlocation not on record | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Richmond, US | 2 |
| Miami, US | 2 |
| Irvine, US | 2 |
| CJBGlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Loja, EC | 2 |
| Lincoln, US | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| Bothell, US | 2 |
| San Jose, US | 2 |
| US | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| KNFYlocation not on record | 2 |
| Porrentruy, CH | 2 |
| Yukon Universitylocation not on record | 2 |
| US | 2 |
| KR | 2 |
| Xian, CN | 2 |
| AUAlocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| Chongqing, CN | 2 |
| Hangzhou, CN | 2 |
| Grand Junction, US | 2 |
| Kuopio, FI | 2 |
| Austin, US | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| GB | 1 |
| Knoxville, US | 1 |
| NoColllocation not on record | 1 |
| TUR-Alocation not on record | 1 |
| Johnson City, US | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 1 |
| Rotorua, NZ | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| USFSlocation not on record | 1 |
| Chengdu, CN | 1 |
| Dresden, DE | 1 |
| KNFSClocation not on record | 1 |
| Oswego, US | 1 |
| Jyväskylä, FI | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Frankfurt am Main | 1 |
| Morgantown, US | 1 |
| Montréal, CA | 1 |
| QAUlocation not on record | 1 |
| Longwood Universitylocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Ensenada, MX | 1 |
| University of South Dakotalocation not on record | 1 |
| Shanghai, CN | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| Palacký University in Olomouclocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Lausanne, CH | 1 |
| PrivatHerblocation not on record | 1 |
| Wlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| BJUlocation not on record | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Honolulu, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| EMTCMlocation not on record | 1 |
| Brookings, US | 1 |
| SEFlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| University of Victorialocation not on record | 1 |
| DULlocation not on record | 1 |
| INFlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Xian, CN | 1 |
| Mexico City, MX | 1 |
| Minia, EG | 1 |
| Hermosillo, MX | 1 |
291 institutions · 7 441 of 7 758 vouchered records shown · 312 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA47 detections
Where the DNA of Anaphalis margaritacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found47
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 47 detections have coordinates
Open the map4 countries0
Managed boreal mixedwood standAlong the base of south-facing slope, mesic …Northern temperate mixedwood standNorthern temperate stand
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.6 °C 6.20–20.2
Seasonal swing summer↔winter27.8 °C
Max temp (day)19.2 °C 11.3–25.0
Min temp (night)12.7 °C 2.10–15.8
Precipitation83.7 mm/mo 54.0–106
Air humidity59.5 % 56.2–65.1
Moisture balance-21.4 mm/mo -80.8–2.10
Vapour deficit700 Pa 482–960
Wind speed2.70 m/s 1.80–4.50
Cloud cover41.3 % 35.5–48.6
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.