Anametis granulata

(Say, 1831) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Anametis

At a glance

Occurrence records93

Data sources6

Biological traits0

DNA specimens9

eDNA detections6

Sources6 archives

Databases and archives Anametis granulata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility93 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF93 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anametis granulata is a species of broad-nosed weevil in the beetle family Curculionidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anametis granulata has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

20Avariable

459Tmostly conserved

610Tvariable

CACATTATATTTTATTTTTAGTGCTTGATCAGGAATAGTAGGAACTTCTCTTAGAATATTAATTCGTACAGAATTAGGAAGCCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.25%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aethiopacorep africanussame family16.7%Oryxolaemus scabiosussame order17.3%Stenocorus schaumiisame order17.3%Lasconotus intricatussame order17.5%Onthophagus rubricatussame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type93 records

Wild obs. + sensor56

Museum / vouchered37

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 16≤1 km 24≤10 km 6>10 km 3

49 georeferenced · 7 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 2≤10 km 22>10 km 3

27 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	19
University of Alabamalocation not on record	4
Wuzhou, CN	3
SSAClocation not on record	2
University of Guelphlocation not on record	1
Chicago, US	1
CUlocation not on record	1
Cambridge, US	1
ASUlocation not on record	1
St. Paul, US	1
Universidad Católica de Manizaleslocation not on record	1

11 institutions · 35 of 37 vouchered records shown · 2 without an institution code

09Environmental DNA6 detections

Where the DNA of Anametis granulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Riparian ZoneForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 11.3–20.0

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.9 °C 17.2–25.1

Min temp (night)14.2 °C 5.70–15.7

Precipitation84.7 mm/mo 70.5–95.7

Air humidity57.3 % 54.7–57.6

Moisture balance-57.7 mm/mo -59.4–-40.2

Vapour deficit855 Pa 616–1,000

Wind speed2.90 m/s 2.60–3.30

Cloud cover41.1 % 40.0–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)