Anaka burmensis

Dworakowska, 1993 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Anaka

At a glance

Occurrence records2

Data sources5

Biological traits0

DNA specimens47

eDNA detections5

Sources5 archives

Databases and archives Anaka burmensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD47 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaka burmensis has left across the world's sequence archives.

At a glance

DNA specimens47

BINs5

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P615 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

24Avariable

27Tmostly conserved

72Tmostly conserved

75Cmostly conserved

117Tmostly conserved

132Amostly conserved

159Amostly conserved

180Amostly conserved

213Amostly conserved

279Amostly conserved

282Tmostly conserved

285Amostly conserved

297Gmostly conserved

331Tmostly conserved

351Tmostly conserved

357Amostly conserved

375Amostly conserved

387Amostly conserved

391Tmostly conserved

396Amostly conserved

460Tmostly conserved

462Amostly conserved

486Amostly conserved

543Gvariable

594Cvariable

600Cmostly conserved

TTTGGTATTTGATCTGGTATAGTAGGTATAATACTTAGTATATTAATTCGTGTTGAATTAGCTCAATTAGGTAGCTTTTTAGGTAGAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes34

BINs5

Most divergent pair4.9%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Homalodisca insolitasame family15.8%Hebata abbreviatasame family16.3%Cuerna costalissame family16.7%Hebata recurvatasame family16.9%Hebata vergenasame family17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_077251 ↗ · 13 protein · 23 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16Srrn12S

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type2 records

Wild obs. + sensor2

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA5 detections

Where the DNA of Anaka burmensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–20.2

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 15.7–24.8

Min temp (night)3.10 °C 3.10–14.8

Precipitation13.8 mm/mo 13.8–173

Air humidity45.7 % 45.7–57.5

Moisture balance-95.2 mm/mo -95.2–36.6

Vapour deficit827 Pa 827–1,072

Wind speed4.50 m/s 2.40–4.50

Cloud cover24.1 % 24.1–25.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)