Anaheterotis pobeguinii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Melastomataceae/Anaheterotis

At a glance

Occurrence records6

Data sources4

Biological traits3

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Anaheterotis pobeguinii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility6 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF6 records

DNA & barcodingNCBIsequences

01Narrative

Anaheterotis pobeguinii is an herb of the family Melastomataceae, in the monospecific genus Anaheterotis. Its species name is an homage to French explorer Charles-Henri Pobéguin

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Size & morphology1

Plant height max0.61 m

Habitat & environment2

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaheterotis pobeguinii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKX889284.1 ↗915 bp

ACGT

AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAAACGAACGGAAGAACGACCAGCGAACTGTCCTCTCGTACCGAGTTG …

Anaheterotis pobeguinii small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type6 records

Museum / vouchered6

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	3
Kew, GB	1

2 institutions · 4 of 6 vouchered records shown · 2 without an institution code