Anagyrus kamali

Moursi, 1948 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Encyrtidae/Anagyrus

At a glance

Occurrence records23

Data sources6

Biological traits0

DNA specimens24

eDNA detections28

Sources6 archives

Databases and archives Anagyrus kamali's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 5 countries28 detections

DNA & barcodingBOLD24 specimens

01Narrative

Anagyrus kamali is een vliesvleugelig insect uit de familie Encyrtidae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1948 door Moursi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anagyrus kamali has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes2

eDNA detections28

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BIN1

Most divergent pair0.16%

Where individuals differ — all 55 variable positions, in barcode order

120Tmostly conserved

129Amostly conserved

141Gmostly conserved

147Gmostly conserved

156Amostly conserved

157Gmostly conserved

171Gmostly conserved

174Amostly conserved

186Amostly conserved

189Amostly conserved

213Gmostly conserved

222Gmostly conserved

249Amostly conserved

251Gmostly conserved

252Tmostly conserved

267Tmostly conserved

270Amostly conserved

282Tmostly conserved

285Tmostly conserved

288Gmostly conserved

291Cmostly conserved

309Amostly conserved

312Tmostly conserved

321Tmostly conserved

327Amostly conserved

345Gmostly conserved

348Tmostly conserved

358Cmostly conserved

360Tmostly conserved

369Gmostly conserved

373Amostly conserved

375Tmostly conserved

390Tmostly conserved

393Amostly conserved

408Tmostly conserved

411Tmostly conserved

414Amostly conserved

447Cmostly conserved

450Amostly conserved

453Gmostly conserved

462Amostly conserved

477Amostly conserved

478Amostly conserved

487Cmostly conserved

489Tmostly conserved

493Cmostly conserved

495Tmostly conserved

507Tmostly conserved

513Amostly conserved

516Tmostly conserved

528Gmostly conserved

529Tmostly conserved

531Amostly conserved

573Amostly conserved

579Tmostly conserved

TTATCTTTAAGAATAATTATTCGTTTGGAATTAGGTATACCTGGTTCTTTGATTGGTAATGATCAAATTTATAATTCAATTGTTACAGCG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gyranusoidea indicasame family9.3%Anagyrus agraensissame genus9.5%Anagyrus orbitalissame genus9.7%Leptomastix mayrisame family10.0%Anagyrus thailandicussame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor5

Museum / vouchered18

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 3

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	6
CTNIlocation not on record	5
The University of Hawaii Insect Museumlocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 16 of 18 vouchered records shown · 1 without an institution code

09Environmental DNA28 detections

Where the DNA of Anagyrus kamali was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map5 countries0

4. Native GrasslandUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 19.7–26.2

Seasonal swing summer↔winter8.40 °C

Max temp (day)26.2 °C 24.6–29.4

Min temp (night)17.7 °C 16.0–24.4

Precipitation5.60 mm/mo 5.60–99.2

Air humidity63.0 % 55.2–63.4

Moisture balance-105 mm/mo -105–85.1

Vapour deficit919 Pa 854–1,387

Wind speed1.20 m/s 1.20–3.90

Cloud cover12.1 % 12.1–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)