Anagyris foetida

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Anagyris

At a glance

Occurrence records5 278

Data sources12

Biological traits21

DNA specimens24

eDNA detections24

Sources12 archives

Databases and archives Anagyris foetida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 278 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources21 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF5 278 records

Environmental DNA1 datasets · 0 countries24 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Anagyris foetida L., l'anagyre fétide ou bois-puant, est une espèce de plantes à fleurs de la famille des Fabaceae. C'est une plante méditerranéenne d'origine probablement grecque qui se retrouve, de nos jours, dans de nombreux territoires méditerranéens. Sa présence dans la nature est plutôt rare. Elle pousse souvent à proximité de lieux historiques tels que des carrières, monastère ou châteaux. Ce qui laisse penser qu'elle a été très anciennement introduite par l'homme à proximité de ces lieux. Il s'agit d'une plante archéophyte.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVPAusTraits

Size & morphology4

Plant height1.5 m

Seed mass363 mg

Seed mass max447 mg

Seed mass min267 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Dehiscencedehiscent

Life formshrub or tree

Life spanperennial

Lifeform raunkiaer detailedphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typelegume

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: tree · TRY: S

Woodinesswoody

Physiology & chemistry4

Leaf n37.2 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)10.48 mm²/mg

Wood density580 mg/cm³

03Chemical composition14 compounds

Compounds documented for Anagyris foetida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Pyridine alkaloids $ Quinolizidine alkaloids10

Quinolizidine alkaloids3

Flavones1

Menthane monoterpenoids1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Lupanine	present	LOTUS
(+)-Thermopsine	present	LOTUS
(1R)-3-(3-Butenyl)-1,2,3,4,5,6-hexahydro-1,5-methano-8H-pyrido[1,2-a][1,4]diazocin-8-one	present	LOTUS
(1R,2R,9S,10R)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one	present	LOTUS
(1R,9R)-11-methyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one	present	LOTUS
(1S,5S)-1,2,3,4,5,6-hexahydro-8H-1,5-methanopyrido[1,2-a][1,5]diazocin-8-one	present	LOTUS
(1S,9S,10R,12R)-12-hydroxy-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadeca-2,4-dien-6-one	present	LOTUS
1,5-Methano-8H-pyrido[1,2-a][1,5]diazocin-8-one, 3-(3-butenyl)-1,2,3,4,5,6-hexahydro-, (1R)-	present	LOTUS
Anagyrine	present	LOTUS
Cytisine	present	LOTUS

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anagyris foetida has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes4

GenBank sequences10

eDNA detections24

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ004318.1 ↗583 bp

ACGT

TCGAAGCCTAACAAAGCAGTGCGACCCGCGAATTTGTTTGACTACTCAGGGGAGGCCAGAGGTGCTTGGCACCTCGGTCCCCTCTTGTGT …

Anagyris foetida internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anagyris foetida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode35records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1835×CCDB · ita-fl · CCDB · iber-fl · CCDB · mediterranean +4

CCDB · ita-fl — Cusma Velari T., Feoli Chiapella L., Kosovel V., Pellizzari L. - 2012. Reports (1761-1762). In: Kamari G., Blanch C., Siljak-Yakovlev S., Mediterranean chromosome number reports - 22. Fl. Medit. , 22: 221-226.

CCDB · ita-fl — OTTONELLO D., ROMANO S., ALLIATA N. - 1986 (1985). Numeri cromosomici per la flora italiana:1037-1048.. Inform. Bot. Ital. , 17(1-2-3): 91-98.

CCDB · ita-fl — COLOMBO P., MARCEN C. & MAZZA S. - 1987 (1987). Numeros cromosomaticos de plantas occidentales, 436 - 444.. Anales Jardin Botanico de Madrid , 44(1): 140 - 142.

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).

CCDB · mediterranean

CCDB · ipcn-api-dl — Colombo, P., C. Marceno & S. Mazza. 1987. Numeros cromosomaticos de plantas occidentales, 436--444. Anales Jard. Bot. Madrid 44: 137–142.

CCDB · ipcn-api-dl — Ottonello, D., S. Romano & N. Alliata. 1985. Numeri cromosomici per la flora Italiana: 1037--1048. Inform. Bot. Ital. 17: 91–98.

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.

CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.

CCDB · book-ipcn67-71 — VAN LOON, J.C., T.W.J. GADELLA, & E. KLIPHUIS. 1971. Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.

CCDB · book-ipcn75-78 — Fernandes & Queiros 1978

CCDB · CromoCat 2015 — Colombo, P., Marcenò, C. & Mazza, S. (1987). Números cromosomáticos de plantas occidentales, 436-444. Anales Jard. Bot. Madrid 44: 137-142.

CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.

CCDB · CromoCat 2015 — Loon van, J. C., Gadella, Th. W. J. & Kliphuis, E. (1971). Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.

CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425

n 91×CCDB · Cannon, 2015

CCDB · Cannon, 2015 — Colombo, P., C. Marceno & S. Mazza, 1987

08Occurrence & distribution

Record type5 278 records

Wild obs. + sensor4 648

Museum / vouchered575

Cultivated / captive5

Other50

Origin

Native185

Range

Area of Occupancy AOO8 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 1 160≤1 km 414≤10 km 724>10 km 89

2 387 georeferenced · 2 261 without coordinates

Open the mapobservation + sensor4 648

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 6≤1 km 100≤10 km 115>10 km 10

231 georeferenced · 344 without coordinates

Open the institutions mapphysical evidence575

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 2

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 59 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	67
BIO-UNIPIlocation not on record	61
Badajoz, ES	54
MAlocation not on record	38
València, ES	36
Córdoba, ES	21
Barcelona, ES	20
College of the Atlantic, Museumlocation not on record	19
BClocation not on record	12
Berlin, DE	11
Entomological Society of Latvialocation not on record	10
BDBClocation not on record	9
Granada, ES	9
Wlocation not on record	9
Alicante, ES	8
Jaén, ES	8
UIBlocation not on record	8
CICYTEXlocation not on record	7
CJBGlocation not on record	7
Adam Mickiewicz University in Poznańlocation not on record	6
Institut und Museum fuer Geologie und Palaeontologielocation not on record	6
ISAlocation not on record	5
Vitoria, ES	5
Rishon Le Zion, IL	5
Sevilla, ES	5
Salamanca, ES	5
Museo Entomologico de Leonlocation not on record	4
Kew, GB	4
Paris, FR	4
Museo Achille Folettolocation not on record	3
Museo della Bonifica di San Donà di Piavelocation not on record	3
BRNUlocation not on record	3
Tampa, US	3
San Sebastián, ES	2
Saint Louis, US	2
Madrid, ES	2
JBSlocation not on record	2
South Kensington, GB	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
Davis, US	2
Karlsruhe, DE	2
Stockholm, SE	2
Moscow State Universitylocation not on record	2
Universität Tübingenlocation not on record	2
Oskarshamn, SE	2
Edinburgh, GB	2
Phyletisches Museum Jenalocation not on record	2
University of Patraslocation not on record	1
Bourges, FR	1
ESP003location not on record	1
Xiamen, CN	1
Adelaide, AU	1
Santiago de Compostela, ES	1
GZUlocation not on record	1
Pamplona, ES	1
Madrid, ES	1
Henry Brockhouse Collectionlocation not on record	1
Dresden, DE	1
JBAlocation not on record	1

59 institutions · 515 of 575 vouchered records shown · 60 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA24 detections

Where the DNA of Anagyris foetida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anagyris foetida

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry4

Compound class profile4 classes

Documented compounds14 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 278 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions31 of 59 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type5 278 records