Anageshna primordialis

Dyar, 1906 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anageshna

At a glance

Occurrence records6 049

Data sources7

Biological traits0

DNA specimens369

eDNA detections385

Sources7 archives

Databases and archives Anageshna primordialis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 049 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI385 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics369 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 049 records

Environmental DNA1 datasets · 2 countries385 detections

DNA & barcodingBOLD369 specimens

01Narrative

Anageshna is a monotypic moth genus of the family Crambidae described by Eugene G. Munroe in 1956. Its only species, Anageshna primordialis, the yellow-spotted webworm, was described by Harrison Gray Dyar Jr. in 1907. It is found in the US states of Alabama, Arkansas, Arizona, Florida, Georgia, Iowa, Illinois, Kansas, Louisiana, Massachusetts, Maryland, Maine, Minnesota, Missouri, Mississippi, North Carolina, New Hampshire, New Jersey, New York, Ohio, Oklahoma, Pennsylvania, South Carolina, Texas, Virginia and West Virginia. The wingspan is about 11 mm. Adults are on wing from August to November. Hosts plants are unknown.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding369 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anageshna primordialis has left across the world's sequence archives.

At a glance

DNA specimens369

BINs1

Marker genes1

eDNA detections385

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus339 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

TACCTTATATTTCATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes16

BIN1

Most divergent pair5.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apogeshna stenialissame family5.4%Lygropia tripunctatasame family6.0%Tyspanodes striatasame family6.0%Glycythyma chrysoryctasame family6.3%Eurybela scotopissame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 049 records

Wild obs. + sensor5 201

Museum / vouchered848

Range

Area of Occupancy AOO10 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 2 780≤1 km 804≤10 km 187>10 km 441

4 212 georeferenced · 989 without coordinates

Open the mapobservation + sensor5 201

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 5≤1 km 32≤10 km 94>10 km 111

242 georeferenced · 606 without coordinates

Open the institutions mapphysical evidence848

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	153
Mississippi State, US	111
East Lansing, US	106
CUlocation not on record	51
Cambridge, US	35
North Carolina State University Insect Museumlocation not on record	33
Georgia Museum of Natural Historylocation not on record	28
Washington, US	24
New Haven, US	22
Philadelphia, US	18
Cornell University Insect Collectionlocation not on record	8
St. Paul, US	8
King Saud Universitylocation not on record	6
Champaign, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Centre for Biodiversity Genomicslocation not on record	3
SOVTlocation not on record	2
UNHClocation not on record	2
University of Alberta Museums (UAM)location not on record	1
Denver, US	1
University of Central Floridalocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

22 institutions · 622 of 848 vouchered records shown · 226 without an institution code

09Environmental DNA385 detections

Where the DNA of Anageshna primordialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found385

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 385 detections have coordinates

Open the map2 countries0

Forest14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland|1.4. Temperate ForestMixed habitatGrasslandWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 15.8–21.2

Seasonal swing summer↔winter26.3 °C

Max temp (day)23.6 °C 18.4–26.5

Min temp (night)15.2 °C 11.7–18.5

Precipitation106 mm/mo 77.5–139

Air humidity60.5 % 57.6–63.9

Moisture balance-25.7 mm/mo -84.3–29.6

Vapour deficit868 Pa 608–1,065

Wind speed2.60 m/s 2.20–5.30

Cloud cover44.6 % 38.3–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 381 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anageshna primordialis

At a glance

Sources7 archives

At a glance

Record type6 049 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 049 records