Anaesthetis testacea

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anaesthetis

At a glance

Occurrence records1 824

Data sources9

Biological traits0

DNA specimens21

eDNA detections40

Sources9 archives

Databases and archives Anaesthetis testacea's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 824 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 824 records

Environmental DNA3 datasets · 5 countries40 detections

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT · TreeOfSex2n = 22

01Narrative

Anaesthetis testacea is a species of longhorn beetle. It is a common species in Europe that develops in the dead, terminal twigs of deciduous trees and shrubs.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaesthetis testacea has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections40

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

7Gvariable

46Cmostly conserved

67Tmostly conserved

70Amostly conserved

103Cmostly conserved

190Avariable

305Gvariable

310Gvariable

316Avariable

343Avariable

353Gvariable

400Cvariable

428Tvariable

550Gmostly conserved

584Avariable

AACTTTGTATTTTGTATTTGGTGCCTGAGCAGGAATGGTAGGAACCTCTTTAAGAATACTTATTCGTTCAGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes6

BIN1

Most divergent pair2.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calathus ambiguussame order14.1%Tachinus lignorumsame order14.4%Calathus micropterussame order14.4%Calathus cinctussame order14.4%Pachyta armatasame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anaesthetis testacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

08Occurrence & distribution

Record type1 824 records

Wild obs. + sensor1 509

Museum / vouchered230

Other85

Range

Area of Occupancy AOO4 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 340≤1 km 193≤10 km 668>10 km 37

1 238 georeferenced · 271 without coordinates

Open the mapobservation + sensor1 509

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 37≤1 km 63≤10 km 63>10 km 7

170 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence230

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	58
Provincia di Livornolocation not on record	19
Brussels, BE	15
Uniwersytet Łódzkilocation not on record	9
NTNU-VMlocation not on record	7
European Distributed Institute of Taxonomy (EDIT)location not on record	6
ZSMlocation not on record	5
Muzeum Górnośląskie w Bytomiulocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	5
Tallinn, EE	4
Paris, FR	3
Tilburg, NL	3
Dhaka, BD	3
RBINS-Scientific Heritagelocation not on record	3
IFR-DNFlocation not on record	2
Salzburg, AT	2
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	2
Nijmegen, NL	2
BioFokuslocation not on record	1
Tartu, EE	1
Helsinki, FI	1
MZLUlocation not on record	1
South Kensington, GB	1

23 institutions · 158 of 230 vouchered records shown · 72 without an institution code

09Environmental DNA40 detections

Where the DNA of Anaesthetis testacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys3

Countries5

Verifiable raw sequence linked20

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map5 countries0

Saulaietrockene EichewalderSaulaie (coupe)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 12.8–19.4

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.1 °C 16.9–23.1

Min temp (night)11.1 °C 7.80–14.7

Precipitation57.4 mm/mo 40.3–78.5

Air humidity58.1 % 57.2–61.0

Moisture balance-55.5 mm/mo -101–-8.00

Vapour deficit726 Pa 623–928

Wind speed2.50 m/s 2.00–4.10

Cloud cover41.7 % 34.8–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaesthetis testacea

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 824 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 824 records