Anaedus brunneus

(Ziegler, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Tenebrionidae/Anaedus

At a glance

Occurrence records257

Data sources5

Biological traits0

DNA specimens5

eDNA detections3

Sources5 archives

Databases and archives Anaedus brunneus's data was compiled from.

GBIFGlobal Biodiversity Information Facility257 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF257 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaedus brunneus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

187Tvariable

214Avariable

451Tvariable

625Gvariable

AACATTATATTTCATTTTTGGAGCTTGATCAGGCATAGTAGGATCCTCATTAAGAATTTTAATTCGAACAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pyrgus carlinaesame order14.1%Pyrgus armoricanussame order14.3%Actinotia intermediatasame order14.4%Pyrgus alveussame order14.4%Eudonia pachysemasame order14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type257 records

Wild obs. + sensor25

Museum / vouchered232

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 14≤1 km 6≤10 km 1

21 georeferenced · 4 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤1 km 20≤10 km 8

28 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence232

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	93
Chicago, US	65
University Park, US	42
CUlocation not on record	14
University of Central Floridalocation not on record	6
Cambridge, US	4
Provo, US	2
Wuzhou, CN	2
University of Alabamalocation not on record	2
College Station, US	1
Lake Placid, US	1

11 institutions · 232 of 232 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Anaedus brunneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 14.7–17.9

Seasonal swing summer↔winter24.4 °C

Max temp (day)20.4 °C 17.8–22.9

Min temp (night)13.0 °C 12.2–13.8

Precipitation87.8 mm/mo 83.0–92.5

Air humidity60.0 % 59.1–60.8

Moisture balance-38.6 mm/mo -48.0–-29.2

Vapour deficit743 Pa 685–802

Wind speed4.50 m/s 3.40–5.50

Cloud cover39.0 % 35.1–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)