Anaea troglodyta

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Anaea

At a glance

Occurrence records323

Data sources8

Biological traits0

DNA specimens46

eDNA detections101

Sources8 archives

Databases and archives Anaea troglodyta's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility323 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI101 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF323 records

Environmental DNA1 datasets · 7 countries101 detections

DNA & barcodingBOLD46 specimens

Genome at a glanceGoaT2n = 30

01Narrative

Anaea troglodyta, the Florida leafwing, Portia or Florida goatweed butterfly, is a butterfly of the family Nymphalidae. It is found in southern Florida and on many islands of the Caribbean. In Jamaica, it is known as the Jamaican tropical leafwing and in the Cayman Islands and Cuba it is known as the Cuban red leaf. The wingspan is 76 -. Adults are on wing from October to April (dry-season form) and from May to October (wet-season form). The larvae feed on Croton cascarilla and Croton linearis. Adults feed on rotting fruit, dung and fluids. Although over 230 species have been included in the genus Anaea, Gerardo Lamas (2004) considers all Anaea populations to represent a single species, Anaea troglodyta (Fabricius 1775).Lamas G ed. (2004) Checklist of Neotropical Butterflies : Part 4A Hesperioidea - Papilionoidea. Gainesville: Scientific Publishers/Association of Tropical Lepidoptera.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaea troglodyta has left across the world's sequence archives.

At a glance

DNA specimens46

BINs4

Marker genes9

eDNA detections101

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

5Cvariable

13Cvariable

22Amostly conserved

40Amostly conserved

46Cvariable

67Tvariable

100Avariable

124Tmostly conserved

133Tmostly conserved

163Tmostly conserved

166Amostly conserved

202Tmostly conserved

205Amostly conserved

220Cvariable

232Tmostly conserved

235Cmostly conserved

238Cvariable

250Tmostly conserved

277Tmostly conserved

287Tmostly conserved

313Tmostly conserved

346Tvariable

364Tvariable

367Tmostly conserved

370Amostly conserved

376Cvariable

379Cvariable

397Cvariable

400Cmostly conserved

401Tvariable

403Avariable

406Tmostly conserved

412Tvariable

418Cvariable

424Tmostly conserved

460Tvariable

477Avariable

514Tmostly conserved

526Tmostly conserved

541Tvariable

547Tmostly conserved

553Tmostly conserved

562Tmostly conserved

607Amostly conserved

610Tmostly conserved

616Tmostly conserved

646Tmostly conserved

AACTCTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTAATTATTCGTACTGAATTAGGTAATCCTGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes14

BINs4

Most divergent pair4.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaea aideasame genus3.5%Anaea eurypylesame genus6.5%Anaea rypheasame genus6.6%Polygrapha cyaneasame family6.7%Memphis perennasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCADEF1-alphaGAPDHIDHMDHRpS2RpS5Wnt1

animal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Anaea troglodyta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

08Occurrence & distribution

Record type323 records

Wild obs. + sensor120

Museum / vouchered203

Range

Area of Occupancy AOO652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 64≤1 km 24≤10 km 8>10 km 12

108 georeferenced · 12 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 6≤1 km 15≤10 km 96>10 km 20

137 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence203

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	66
East Lansing, US	36
Mexico City, MX	32
Cambridge, US	19
Mayagüez, PR	16
MZLUlocation not on record	11
Zürich, CH	4
Washington, US	4
Saint John, CA	2
Universidad Católica de Manizaleslocation not on record	1
Chicago, US	1
El Colegio de la Frontera Surlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

13 institutions · 194 of 203 vouchered records shown · 9 without an institution code

09Environmental DNA101 detections

Where the DNA of Anaea troglodyta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found101

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 101 detections have coordinates

Open the map7 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…1. Forest & Woodland|1.5. Subtropical/Tropic…Thorn desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 20.9–27.1

Seasonal swing summer↔winter2.80 °C

Max temp (day)27.6 °C 25.5–30.0

Min temp (night)22.0 °C 17.0–24.1

Precipitation274 mm/mo 49.8–384

Air humidity66.9 % 60.0–70.2

Moisture balance113 mm/mo -83.1–228

Vapour deficit1,017 Pa 880–1,327

Wind speed3.00 m/s 1.20–4.20

Cloud cover34.6 % 21.8–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 95 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)