Anaea andria

Scudder, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Anaea

At a glance

Occurrence records7 382

Data sources7

Biological traits0

DNA specimens10

eDNA detections12

Sources7 archives

Databases and archives Anaea andria's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 382 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 382 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD10 specimens

01Narrative

Anaea andria, known generally as the goatweed leafwing or goatweed butterfly, is a species of leafwing in the butterfly family Nymphalidae. It is found in North America. The MONA or Hodges number for Anaea andria is 4554. Goatweed leafwing, Anaea andria

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaea andria has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

313Cvariable

368Gmostly conserved

433Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGTTTAATTATTCGTACTGAATTAGGTAATCCTGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaea aideasame genus3.3%Anaea eurypylesame genus6.7%Anaea rypheasame genus6.7%Polygrapha cyaneasame family6.7%Anaea glyceriumsame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 382 records

Wild obs. + sensor6 987

Museum / vouchered395

Range

Area of Occupancy AOO14 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 3 235≤1 km 1 390≤10 km 528>10 km 441

5 594 georeferenced · 1 393 without coordinates

Open the mapobservation + sensor6 987

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 1≤1 km 16≤10 km 194>10 km 112

323 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence395

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	97
OSUClocation not on record	56
Cambridge, US	53
East Lansing, US	36
Natural History Museum of Utahlocation not on record	22
Georgia Museum of Natural Historylocation not on record	22
ASUlocation not on record	20
King Saud Universitylocation not on record	18
Denton, US	17
Philadelphia, US	14
Mississippi State, US	7
Blacksburg, US	7
Sam Noble Oklahoma Museum of Natural Historylocation not on record	6
Denver, US	4
Natural History Museum Rotterdamlocation not on record	3
University of Alberta Museums (UAM)location not on record	2
Chicago, US	2
Zürich, CH	2
Vernal, US	2
Tapachula, MX	1
CUlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Chicago, US	1
US	1

24 institutions · 395 of 395 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Anaea andria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 19.0–25.9

Seasonal swing summer↔winter24.0 °C

Max temp (day)26.8 °C 25.5–31.3

Min temp (night)16.6 °C 14.3–21.5

Precipitation97.6 mm/mo 63.8–129

Air humidity57.6 % 55.1–58.5

Moisture balance-76.9 mm/mo -93.4–-21.0

Vapour deficit1,022 Pa 945–1,476

Wind speed4.10 m/s 3.70–5.30

Cloud cover29.8 % 29.1–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaea andria

At a glance

Sources7 archives

At a glance

Record type7 382 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 382 records