Anadara cornea

(Reeve, 1844) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Arcida/Arcidae/Anadara

At a glance

Occurrence records47

Data sources7

Biological traits7

DNA specimens25

eDNA detections22

Sources7 archives

Databases and archives Anadara cornea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

OBISOcean Biodiversity Information System17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS47 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD25 specimens

01Narrative

Anadara cornea is een tweekleppigensoort uit de familie van de Arcidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1844 door Reeve.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length6 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max20 m

Depth min0 m

Vulnerability10

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anadara cornea has left across the world's sequence archives.

At a glance

DNA specimens25

BINs3

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P397 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

1Tmostly conserved

4Tmostly conserved

7Gmostly conserved

13Cmostly conserved

25Cmostly conserved

34Amostly conserved

44Tmostly conserved

46Gmostly conserved

49Amostly conserved

64Tmostly conserved

68Cmostly conserved

76Amostly conserved

79Gmostly conserved

82Gmostly conserved

85Gmostly conserved

88Gmostly conserved

97Gmostly conserved

106Cmostly conserved

112Amostly conserved

121Amostly conserved

130Tmostly conserved

135Gmostly conserved

149Gmostly conserved

163Cmostly conserved

178Amostly conserved

181Gmostly conserved

187Gmostly conserved

190Amostly conserved

202Tmostly conserved

205Gmostly conserved

211Cmostly conserved

259Cmostly conserved

274Cmostly conserved

277Gmostly conserved

286Tmostly conserved

301Gmostly conserved

305Cmostly conserved

319Tmostly conserved

322Amostly conserved

340Tmostly conserved

347Tmostly conserved

349Amostly conserved

352Gmostly conserved

358Cmostly conserved

361Cmostly conserved

364Tmostly conserved

379Cmostly conserved

391Amostly conserved

397Gmostly conserved

TCCTCGGCTTAACAATTTTAGATACTGGATTTTACCTGGTGCTTTGTTAATGGTAATTATTTCTGCCCTAATTGAAGGGGGGGTGGGGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes4

BINs3

Most divergent pair12.1%

Asia

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type47 records

Wild obs. + sensor17

Museum / vouchered30

Range

Area of Occupancy AOO92 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 16 m · max 86 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 15 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 1>10 km 5

8 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ocean University of China Museumlocation not on record	7
Philadelphia, US	5
Denver, US	2
Natural History Museum of Utahlocation not on record	1
Provincia di Livornolocation not on record	1
Salzburg, AT	1
RBINS-Scientific Heritagelocation not on record	1
Brussels, BE	1

8 institutions · 19 of 30 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Anadara cornea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)