Anadara brasiliana

(Lamarck, 1819) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Arcida/Arcidae/Anadara

At a glance

Occurrence records2 429

Data sources8

Biological traits2

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Anadara brasiliana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 151 records↗

OBISOcean Biodiversity Information System278 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS2 429 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anadara brasiliana, common name the incongruous ark clam, is a saltwater clam in the family Arcidae, the ark shells. This species is found along the Atlantic coast of North America, from North Carolina to Brazil.Abbott, R.T. & Morris, P.A. A Field Guide to Shells: Atlantic and Gulf Coasts and the West Indies. New York: Houghton Mifflin, 1995. 9.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anadara brasiliana has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P458 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

7Tmostly conserved

10Tmostly conserved

175Cmostly conserved

262Cmostly conserved

310Cmostly conserved

394Tmostly conserved

ATTTCATATTCGTTTGAATTTAGCTCAGCCTGGTGGGATTTATAGAGAACTACCACAAATGTATAACGTTATTGTAACTGGCCATGCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes3

BINs0

Most divergent pair0.66%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 429 records

Wild obs. + sensor1 583

Museum / vouchered779

Cultivated / captive4

Fossil30

Other33

Origin

Native7

Range

Area of Occupancy AOO3 876 km²

Depth

0–200 m sunlit75

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 48 m · 75 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 924≤1 km 217≤10 km 118>10 km 81

1 340 georeferenced · 243 without coordinates

Open the mapobservation + sensor1 583

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 4≤1 km 62≤10 km 95>10 km 44

205 georeferenced · 574 without coordinates

Open the institutions mapphysical evidence779

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	54
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	53
Cambridge, US	44
Chongqing Museumlocation not on record	43
UNICAMPlocation not on record	42
Delaware Museum of Nature and Sciencelocation not on record	39
Chicago, US	35
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	28
North Carolina Museum of Natural Scienceslocation not on record	21
Los Angeles, US	19
Denver, US	11
PUC-RSlocation not on record	11
Saint John, CA	10
Santa Barbara Museum of Natural Historylocation not on record	10
Champaign, US	8
Paleontological Research Institutionlocation not on record	7
Texas Cooperative Wildlife Collectionlocation not on record	7
The University of the West Indies, Trinidad and Tobagolocation not on record	6
Provincia di Livornolocation not on record	4
UM-RSMASlocation not on record	4
Sistema de Colecciones Biológicas, Escuela de Biología, Universidad de San Carlos de Guatemala location not on record	4
Natural History Museum Rotterdamlocation not on record	3
ELMClocation not on record	3
Universidad del Valle de Guatemalalocation not on record	3
Washington, US	3
EL PASO, US	2
Auckland, NZ	2
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	2
Toronto, CA	2
Ann Arbor, US	2
Helsinki, FI	1
Paris, FR	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

33 institutions · 485 of 779 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Anadara brasiliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anadara brasiliana

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type2 429 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 33 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 429 records