Anacyclus pyrethrum

(L.) Link · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Anacyclus

At a glance

Occurrence records85

Data sources13

Biological traits11

DNA specimens14

eDNA detections13

Sources13 archives

Databases and archives Anacyclus pyrethrum's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility85 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS116 compounds

Occurrence & distributionGBIF85 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Der Deutsche Bertram (Anacyclus officinarum) war eine Pflanzenart aus der Familie der Korbblütler (Asteraceae). Er wurde etwa bis zum Wechsel vom 19. zum 20. Jahrhundert seiner Wurzel wegen als Heilpflanze kultiviert.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.4 m

Life cycle & reproduction5

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

⚠ sources differ — TRY: perennial · GIFT: annual

Raunkiær life formtherophyte

Habitat & environment3

Climatesubtropical

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Shoot orientationascending

03Chemical composition116 compounds

Compounds documented for Anacyclus pyrethrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

N-acyl amines12

Lanostane, Tirucallane and Euphane triterpenoids8

Pimarane and Isopimarane diterpenoids5

Serratane triterpenoids5

Abietane diterpenoids5

Documented compounds116 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-3-Carene	present	NPASS
(+)-alpha-Pinene	present	NPASS
(+)-beta-Phellandrene	present	NPASS
(-)-beta-Phellandrene	present	NPASS
(-)-beta-Pinene	present	NPASS
(-)-Borneol	present	NPASS
(1R,4aS,4bR,7R,9R,10aR)-7-ethenyl-1-(hydroxymethyl)-1,4a,7-trimethyl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthren-9-ol	present	NPASS
(1R,4aS,4bR,8aS,10aS)-8a-ethenyl-1,4a,7-trimethyl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid	present	NPASS
(1R,4aS,4bS,10aR)-1,4a-dimethyl-7-propan-2-yl-2,3,4,4b,5,6,10,10a-octahydrophenanthrene-1-carboxylic acid	present	NPASS
(1S,6R,11R,12S,15S,16R,19S,21R)-19-methoxy-1,7,7,11,16,20,20-heptamethylpentacyclo[13.8.0.03,12.06,11.016,21]tricos-3-en-8-one	present	NPASS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacyclus pyrethrum has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences10

eDNA detections13

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX869267.1 ↗450 bpIndia · 2025

ACGT

GGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCG …

Anacyclus pyrethrum voucher U104 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★ITS9trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Anacyclus pyrethrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode17records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1817×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +2

CCDB · ipcn-api-dl — Nagl, W. & F. Ehrendorfer. 1974. DNA content, heterochromatin, mitotic index and growth in perennial and annual Anthemideae (Asteraceae). Pl. Syst. Evol. 123: 35–54.

CCDB · ipcn-api-dl — Schweizer, D. & F. Ehrendorfer. 1976. Giemsa banded karyotypes, systematics and evolution in Anacyclus (Asteraceae-Anthemideae). Pl. Syst. Evol. 126: 107–148.

CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 395–401.

CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.

CCDB · ipcn-api-dl — Vogt, R. & C. Oberprieler. 1993. Chromosome numbers of north African phanerograms. I. Fl. Medit. 3: 187–210.

CCDB · book-fedorov — Martinez Vazquez 1962

CCDB · book-fedorov — Martinez Vazquez 1960

CCDB · book-fedorov — Raves 1926 (D. 1955)

CCDB · book-atlas-flowering-plants — Raves 1926

CCDB · kew — Nagl W, Ehrendorfer F. 1974. DNA content, heterochromatin, mitotic index, and growth in perennial and annual Anthemidea (Asteraceae). Plant Systematics and Evolution 123: 35-54.

CCDB · Cave1963 — Martinez 1962

n 92×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 395–401.

CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type85 records

Wild obs. + sensor69

Museum / vouchered16

Origin

Introduced17

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 20≤1 km 19≤10 km 14>10 km 2

55 georeferenced · 14 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 2>10 km 2

6 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BClocation not on record	4
MAlocation not on record	3
Barcelona, ES	2
BDBClocation not on record	1
JBCLMlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

7 institutions · 13 of 16 vouchered records shown · 3 without an institution code

09Environmental DNA13 detections

Where the DNA of Anacyclus pyrethrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter19.5 °C

Max temp (day)31.4 °C

Min temp (night)16.2 °C

Precipitation4.40 mm/mo

Air humidity43.8 %

Moisture balance-164 mm/mo

Vapour deficit1,848 Pa

Wind speed4.30 m/s

Cloud cover22.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)