Anacridium aegyptium

(Linnaeus, 1764) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Anacridium

At a glance

Occurrence records45 925

Data sources8

Biological traits0

DNA specimens33

eDNA detections30

Sources8 archives

Databases and archives Anacridium aegyptium's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 925 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF45 925 records

Environmental DNA1 datasets · 7 countries30 detections

DNA & barcodingBOLD33 specimens

01Narrative

Anacridium aegyptium, the Egyptian grasshopper or Egyptian locust, is a species of insect belonging to the subfamily Cyrtacanthacridinae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacridium aegyptium has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes2

eDNA detections30

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

19Cmostly conserved

91Amostly conserved

94Amostly conserved

172Tmostly conserved

205Gmostly conserved

271Amostly conserved

286Cvariable

428Cmostly conserved

528Cmostly conserved

536Cmostly conserved

634Tvariable

658Cmostly conserved

TACTTTATACTTTCTATTCGGTGCATGAGCAGGAATAGTAGGAACATCTATAAGAATAATTATTCGTGCTGAACTGGGTCAACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes13

BIN1

Most divergent pair1.8%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Schistocerca gregariasame family9.6%Schistocerca quisqueyasame family9.9%Schistocerca flavofasciatasame family10.2%Schistocerca lineatasame family10.3%Schistocerca rubiginosasame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type45 925 records

Wild obs. + sensor45 676

Museum / vouchered210

Other39

Origin

Native1 155

Range

Area of Occupancy AOO77 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 19 893≤1 km 6 774≤10 km 8 175>10 km 1 419

36 261 georeferenced · 9 415 without coordinates

Open the mapobservation + sensor45 676

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 10≤1 km 30≤10 km 69>10 km 11

120 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	53
Salzburg, AT	19
ORTHATlocation not on record	12
Museu Nacional de História Natural e da Ciêncialocation not on record	12
Helsinki, FI	10
Musee d'Histoire Naturallelocation not on record	8
Paro, BT	6
Geneva, CH	6
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
Radicondoli, IT	5
Tartu, EE	4
Universität Zürich, Naturhistorisches Museumlocation not on record	3
Bern, CH	3
BD-CSIClocation not on record	3
Provincia di Livornolocation not on record	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Brussel, BE	2
CIBIOlocation not on record	2
Banyoles, ES	2
Natural History Museum, Rangoonlocation not on record	2
John May Museum of Natural Historylocation not on record	1
Zürich, CH	1
Naturhistorisches Museum Wienlocation not on record	1
Tromsø, NO	1
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	1
MZIANlocation not on record	1
Philadelphia, US	1
MZLUlocation not on record	1
ZSMlocation not on record	1
SFRAlocation not on record	1

30 institutions · 173 of 210 vouchered records shown · 35 without an institution code

09Environmental DNA30 detections

Where the DNA of Anacridium aegyptium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map7 countries0

Rivuline vegetationgrassland14. Artificial - Terrestrial | 14.5 Urban Ar…eucalyptus plantation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 13.6–34.8

Seasonal swing summer↔winter19.4 °C

Max temp (day)25.8 °C 18.2–42.1

Min temp (night)14.0 °C 8.10–27.4

Precipitation32.1 mm/mo 10.1–66.8

Air humidity50.2 % 32.1–58.6

Moisture balance-92.1 mm/mo -202–-42.8

Vapour deficit1,096 Pa 668–2,869

Wind speed3.50 m/s 1.60–4.20

Cloud cover34.4 % 1.60–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anacridium aegyptium

At a glance

Sources8 archives

At a glance

Record type45 925 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type45 925 records