Anachloris tofocolorata

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Anachloris

At a glance

Occurrence records69

Data sources5

Biological traits0

DNA specimens37

eDNA detections36

Sources5 archives

Databases and archives Anachloris tofocolorata's data was compiled from.

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 1 countries36 detections

DNA & barcodingBOLD37 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anachloris tofocolorata has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections36

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 3 variable positions, in barcode order

46Amostly conserved

160Amostly conserved

166Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eulepidotis punctilineasame order7.3%Eois spnrsame family7.5%Phyllodonta cataphractasame family7.8%Eulepidotis stigmasticasame order8.1%Schinia cumatilissame order8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor43

Museum / vouchered26

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 15≤1 km 7≤10 km 6>10 km 3

31 georeferenced · 12 without coordinates

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	14
Natick, US	5
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
ZSMlocation not on record	1
Australian National Insect Collectionlocation not on record	1

5 institutions · 23 of 26 vouchered records shown · 3 without an institution code

09Environmental DNA36 detections

Where the DNA of Anachloris tofocolorata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 15.8–22.7

Seasonal swing summer↔winter11.5 °C

Max temp (day)25.0 °C 18.8–30.2

Min temp (night)15.0 °C 12.2–16.6

Precipitation28.5 mm/mo 10.2–50.7

Air humidity52.9 % 50.0–58.8

Moisture balance-134 mm/mo -181–-43.3

Vapour deficit1,084 Pa 758–1,378

Wind speed3.40 m/s 2.90–4.20

Cloud cover10.8 % 9.40–17.8

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)